* [[:games:sc13|Return to the SC13 Main Page]]
* [[:games:sc13:guides|Return to the SC13 Guides Page]]
====== Guide to Genetics ======
===== The Department =====
Welcome to Genetics. Just across the morgue lies a mystical realm where some of NovusCorp's greatest minds entertain themselves by tying the Human Genome into knots.
The first thing you're going to see is that there are two major sections in this department. The first, the one you walk into as you enter from Medbay, is the Cloning room. It has only one Cloning Console, one DNA Scanner, and one Cloning Pod. More on this later.
The second room is the one where you're going to spend the most of your time. This is where things get done, where people go to become hulking supermutants, where you are going to do. Your. Job. This room has two DNA Scanners and two DNA Scanner Access Consoles, along with two diskette boxes and a few lockers. The medicine locker has a syringe box and anti-toxin bottles. This is quite useful, as any tampering with genetic code gives Toxin damage. The bio-hazard locker has pretty much what you expect it to have - a bio suit and bio hood. Useful if a disease breaks out. The diskettes are also extremely useful, as we will see later.
The third room has your test subjects! These monkeys are going to be your guinea pigs, you are going to experiment on them, and make them suffer quite a bit. It's pretty inhumane. But such is life, and after a few seconds, it will all be worth it. They actually have it pretty easy, it's better than getting gibbed and eaten.
This is going to be your home, buddy. Get used to it. It grows on ya!
==== The Fine Art of Cloning ====
When you first hear about "cloning", you may think that people are referring to making many clones of yourself so you can take over the station. This is not the case (although that can be done too, just not exactly that way). Cloning is a process of using a genetic scan and brain scan from someone to restore them when they have died.
To get a genetic scan, you need a body (alive, or dead but in reasonably intact shape) and cloning equipment, which can be found in your Cloning Room.
* First of all, you have to know that for all things cloning, the Chief Medical Officer has a final say. He is your boss on this side of Genetics. If he tells you to clone someone and not some other guy, you do it. The only person with higher say than him on these matters is the Captain.
* On to specifics! Assuming you are attempting to clone someone who has recently died, and who either doesn't have a genetic scan on file or who needs to be updated, you will want to conduct a genetic scan first - just grab the body and stuff it into the DNA Scanner and close the door. (You can remove them from the Scanner by opening the door, unless the Scanner is locked.)
* Once your subject is inside the DNA Scanner, head over to the Cloning Console and hit the 'Start Standard Scan' button. Depending on the condition of the body and whether their ghost is available, you will see several outcomes.
* If there is no ghost inside the corpse, you will see a 'Brainscan Interface Error'. While you will get the brainscan and genetic scan, this is your warning that cloning this individual may not give you the original personality. Don't worry, you can still conduct the scan, at least. (The ghost of the person who died will get an alert when this occurs, which will hopefully give them time to prepare to inhabit their new body.) Suicides will always have 'Brainscan Interface Error' and will NOT be alerted that they have a potential clone to inhabit; it's presumed that they no longer are interested in their prior life.
* If there is a ghost inside the corpse (or if it's still alive), you should get a 'Brainscan Complete' message; this means that you should be able to clone this individual and expect the clone to behave more or less like the original, as the same player will be inhabiting it.
* If the brain has suffered severe damage (particularly if the individual is dead), you may get a 'Brainscan Corrupted, File Not Updated' error - this means that the brainscan is insufficient, and cloning them if only this scan is available will result in a random ghost (or game AI) taking over the body instead.
* In either case, if the genetic markers are not decayed beyond readability, you should also get a 'Genetic Data Recorded' or 'Genetic Data Updated' message, and you can now produce that individual. If you do not receive this message (body too far damaged or decayed), hopefully you can scan the brain and combine it with a more functional body!
* In keeping with NovusCorp regulations, genetic and brain scans are retained on file for each crewmember in the event of an unfortunate accident, and can be updated at any time by the consent of the scanned. Typically, only a single copy is retained on file; however, you can also use a Datadisk to save a person's genetic and brainscan data, and stealing this data can be the objective of an antagonist.
Once you have successfully updated the genetic data of an individual, you can clone them! Note that by default, it will upload the brainscan of the individual -- which, assuming that individual is deceased, will allow them to return to their body. However, if that individual is already alive, unscanned, or otherwise unavailable, another player can choose to inhabit the body, and may choose a radically different personality. As such, you should typically only be cloning people after they are confirmed deceased (and should not be cloning people who have become a danger to the crew.) Check the Cloning Console to continue.
* Once you have updated the records, click Check Records, and then select the person who you want cloned. You will see an overview of their current genetic structure - their UI+UE (Unique Identifiers + Unique Enzymes) and their SEs (Structural Enzymes), which are quite irrelevant to attempting to clone them. Instead, Click the 'Begin Cloning' button. You will notice that the Cloning Pod is now fully active, and soon you should see a shadow inside. That is the new body being vatgrown and programmed. You can now take the old corpse out of the DNA Scanner, strip it completely so the cloned person can have their stuff back, and place the old corpse in the morgue. You don't have to worry about it anymore.
* The cloning process takes a few minutes, which may seem like an eternity to whoever is getting cloned based on the game's pacing, but isn't too long from your perspective. While the guy is getting his new body set up, take his belongings and stuff them all in the locker right by the cloning pod, so their stuff isn't scattered all over. Plus, cloning the captain and leaving his ID and other secure items on the floor is never a good idea.
* Hypercloning: Use this if you are in a hurry to repopulate the ship or need to build yourself an army and you'll be 3x as efficient at cloning. During the cloning process, it is possible to eject the incomplete clone by unlocking the Cloning Pod with your ID and ejecting the unfinished clone (needs to be >40% done) or by getting an Engineer to unlock the Genetics APC so you can shut off the power temporarily, which also causes the clone to (instantly, no matter how done) eject.
* The clone will not live long and cannot function like this, so it needs to be stuffed into a Cryogenics chamber where the Cryoxodone will repair the remaining cellular damage.
* After the clone has been finished cryogenic treatment, give them Mannitol if some was not included in the Cryotube's chemical mixture.
* After the pod is empty, feel free to start cloning your next patient, if necessary, and to let the old one out, since they most likely don't have clearance to open the door.
* If R&D has been doing their job, they might upgrade the cloner to a level where it can autoprocess. If this is the case, you only have to press the Autoprocess button on top of the window, and the cloner will scan anyone put into it automatically (which allows people to update themselves easily if they have access to the DNA scanner, and expedites processing of bodies), and will begin making a clone of anyone in the backup storage as soon as they are confirmed dead by suit sensors.
=== Hark! A Husk! ===
So you've come across a husk (a gray, dead guy) on your floor, which means you may have problems cloning that poor sod. Before you go throwing that body in the morgue, they can still be helped!
* First off, make sure it's a husk. Throw the body into a DNA Scanner; if it says "Genetic Data Insufficient to Record", then you have yourself a husk. There's also a good chance it will give you a "Brainscan Corrupted" error, if the brain is too deteriorated to scan properly, which means you may be out of luck.
* If you are fortunate, you can identify the individual based on available evidence (suit sensors, ID, distinguishing apparel, testimony, etc.) Assuming such is the case, you can then start the clone based on the backup of the person you think you've found. If you're wrong, however, you will probably end up with a game AI-controlled non-functional madman.
* If your DNA Scanner has received the right upgrades, you can garner genetic data even from seemingly husked individuals, so if you know the Scientists are on the ball, you may want to ask them to upgrade your equipment.
* As a last resort, you can attempt to use some less-than-ethical methods to restore the individual if you can get a brainscan but can't match it to a proper body:
* Take the body down to Surgery.
* Pester the CMO or a Medical Doctor to extract the brain, or do it yourself.
* Run back to Genetics and grab a humanized monkey.
* Return to Surgery and remove his brain too. Do whatever you want with that one, it isn't important.
* Now shove the husk's brain into the monkeyman's corpse.
* Bring the corpse back to Genetics and clone the monkeyman.
* If all goes well then your cadaver will be reborn! Admittedly in a different body, but at least he's back... right?
=== Helping the Headless ===
Sometimes you'll find corpses who are lacking a head. Since a successful brainscan requires a brain, you cannot directly clone them.
* If you have the head, but no body, use a surgical saw or any sharp item (such as a glass shard) to extract the brain, then put it in a monkeyman's corpse, using the same procedure as above, so that you can successfully scan and clone them. Be sure to use the Brainscan Only option so that you can use their backup DNA on file, if it exists.
* If you also have the body, you can just attach the head via surgery before putting it in the scanner.
* If you only have the brain, but you have the body, get robotics to augment the body with a cybernetic head, then insert the brain in there, and put the body in the scanner.
* If you don't have the head, but you have the body, not all hope is lost: take a blood sample and give it to the botanist. If they make a Replica Pod, the deceased guy will be reborn as a podperson!
=== DNA Modification ===
Your boss when it comes to genetic Science is not the Chief Medical Officer. Do not feel forced to listen to his orders, except when it comes to cloning. Regarding the research, listen to direct orders from the Research Director as well as the Captain, and for security reasons allow NO ONE ELSE in the Modification room. Simple as that.
Now, let's get you acquainted with the DNA Scanner Access Consoles next to the monkeys. It has a few things of note. First of all, you're going to notice two clickable lines:
* Modify Unique Enzymes (UE) / Unique Identifiers (UI)
* Modify Structural Enzymes (SE)
You might ask yourself: What does this mean?
* Unique Enzymes = These are what identify who you are, most particularly your name. Changing them has no direct effect, but it means that your UE will not match up to the UE in the backup scan. Transferring your UE to another person will effectively change their name as far as the system is concerned.
* Unique Identifiers = These are your cosmetic details - eye color, skin color, hair style, hair color and gender. You don't really have to mess with any of these, and they are mostly unimportant.
* Structural Enzymes = These contain data relevant to your genetic structure. This governs your species and your genetic abilities, and messing with it carelessly might give you disabilities. For those that handle genes with care, however, great benefits are to be had.
[3F3] [5B1] [4A7] [391] [7FF] [102] [07E]
[7B9] [130] [230] [4E0] [552] [7A4] [715]
Structural Enzymes or SEs look like this. Well, not exactly this; this is just an example. Everyone's SEs are individualized at the start of a round. The SEs consist of characters divided into sub-blocks with three pieces each. Let's see what purpose these blocks and characters have.
=== Structural Enzymes - Powers, Disabilities & Species ===
There is one block which controls whether the subject is a human or something else, and a number of other blocks which control potentially interesting segments of DNA. Altering those segments may result in genetic disabilities or special powers. Each three-digit string is in Hexadecimal - which means base 16 in math terms. It means a number can range from 0 - as normally, zero - to F - equivalent of 15.
That means that a result of F is higher than a result of E. This is important, so remember this.
"Keep this block below 8xx", means you have to keep the first sub-block in a block below 8, and the subsequent sub-blocks don't matter. "Keep that block above DAC", means that that block must have it's first sub-block equal to or higher than D, if it is equal, the second sub-block must be equal to or higher than A... and so forth.
The first number in each block is the most important one. It controls whether a disability is active or inactive, whether a power has a chance to activate or not, and the race of the subject.
=== Mutations and Their Connotations ===
Before we start splicing, you must know what possible monstrosities can be done to a human.
^ Mutation Name ^ Description ^ Indicators ^ Message ^
| Telekinesis | This power allows the subject to control things with their mind, from far away! It is the most sought after power, since it allows for incredible deeds, and makes a talented player nearly immortal. | Appears as a blue glow around the subject's head. | "You feel smarter." |
| Hulk | This is pretty obvious. Subject becomes extremely strong, enough to punch through reinforced walls, and is unable to speak without yelling. The subject is also immune to stuns and cannot be pushed past. This mutation is lost when the subject falls to critical health. | Subject turns green and has red eyes. | "Your muscles hurt." |
|-
!Cold Resistance
|This makes the subject resistant to cold and lack of pressure, effectively allowing it to survive in space (they still have to wear internals, however). This will not make them immune to fire.
|Subject has a pulsating orange-blueish "aura".
|style='color:#0000ff'|''"Your body feels warm."''
|-
!X-Ray Vision
|Also a very good power. Basically, it gives the subject the ability to see everything that is beyond their normal vision: walls, furniture, even other people! This, combined with Telekinesis, is a deadly combination.
|Subject's eyes ''"glow eerily"'' if looked at with a penlight.
|style='color:#0000ff'|''"The walls suddenly disappear."''
|-
!Chameleon
|The subject becomes able to subtly alter light patterns to become invisible, as long as they remain still.
|Subject starts fading into the background.
|style='color:#0000ff'|"''You feel one with your surroundings.''"
|-
!Dwarfism
|Turns the subject into a manlet, making them unusually shorter than the rest of the crew. Dwarfs can pass over tables without stopping.
|Subject looks smaller.
|style='color:#0000ff'|''"Everything around you seems to grow.."''
|-
!Nearsightedness
|Makes the subject's screen go hazy at about halfway from the edge of your whole vision. It's not THAT bad, and can be temporarily fixed by using prescription glasses.
|\
|style='color:#ff0000'|''"Your eyes feel strange."''
|-
!Epilepsy
|Subject starts to fall down and keeps shaking all the time. They're horrible, and there's no easy cure short of fixing the block.
|Subject falls down.
|style='color:#ff0000'|''"You get a headache."''
|-
!Coughing
|Makes the subject drop small items you're holding, like syringes. Pretty harmless, but has potential to be extremely annyoing.
|Subject coughs.
|style='color:#ff0000'|''"You start coughing."''
|-
!Tourette's Syndrome
|The subject swears all the time. They may also experience paralysis that takes even longer than the seizures. Avoid.
|Subject curses out loudly and twitches.
|style='color:#ff0000'|''"You twitch."''
|-
!Nervousness
|Makes the subject stammer. Annoying at best.
|Subject stammers when they speak.
|style='color:#ff0000'|''"You feel nervous."''
|-
!Blindness
|Subject goes completely blind and are now a part of a usually forgotten minority, so sad.
|Subject's eyes don't react to penlight.
|style='color:#ff0000'|''"You can't seem to see anything."''
|-
!Deafness
|Makes the subject deaf. Harmless at best, annoying at worst. You just don't hear anything, not even yourself.
|\
|style='color:#ff0000'|''"You can't seem to hear anything..."''
|-
!Clumsiness
|Subject has a clown-like clumsiness. For those that have always wanted to be clowns. It makes the subject accidentally drop things they hold, unable to use tasers, handcuffs, guns exploding in their face etc.
|\
|style='color:#ff0000'|''"You feel lightheaded."''
|-
!Strangeness
|Makes the subject randomly mutate. Very dangerous. Definitely be careful with this one.
|Subject mutates on their own.
|style='color:#ff0000'|''"You feel strange."''
|-
!Unintelligible
|Heavily corrupts the part of the brain responsible for forming spoken sentences, causing the subject to only be able to speak short sentences.
|\
|style='color:#ff0000'|''"You can't seem to form any coherent thoughts!"''
|-
!Mute
|Completely shuts down the speech center of the subject's brain.
|\
|style='color:#ff0000'|''"You feel unable to express yourself at all."''
|-
!Wacky
|Forces the subject to talk in an odd manner.
|\
|''"You feel an off sensation in your voicebox."''
|-
!Cloak of Darkness
|Enables the subject to bend low levels of light around themselves, creating a cloaking effect. '''No Longer in Genetics, but can be acquired via admin spawned injector'''
|Subject is able to become invisible in low light situations.
|"''You begin to fade into the shadows.''"
|-
!Smile
|Causes the speech center of the subject's brain to produce large amounts of seratonin and a chemical resembling ecstacy when engaged. '''No Longer in Genetics, but can be acquired via admin spawned injector'''
|\
|''"You feel so happy. Nothing can be wrong with anything. :)"''
|-
!Chav
|Forces the language center of the subject's brain to construct sentences in a more rudimentary manner. '''No Longer in Genetics, but can be acquired via admin spawned injector'''
|\
|''"Ye feel like a reet prat like, innit?"''
|-
!Swedish
|Forces the language center of the subject's brain to construct sentences in a vaguely norse manner. '''No Longer in Genetics, but can be acquired via admin spawned injector'''
|\
|''"You feel Swedish, however that works."''
|-
!Elvis
|Forces the language center and primary motor cortex of the subject's brain to talk and act like the King of Rock and Roll. '''No Longer in Genetics, but can be acquired via admin spawned injector'''
|\
|''"You feel pretty good, honeydoll."''
|-
|}
'''IMPORTANT: There's also ''1 special block'' which contains the info whether the subject is a ''human or a monkey''!'''
=== Buffers and Injectors - Saving Your Work and Handing Out Godhood ===
* This is how you '''save your work'''. A very good Geneticist once said: Save early, save often. His words are true. You have to save your every step in order to acquire a perfect serum. That means you have to be patient enough to bend the block to your will, dedicated enough to remove every disability, and responsible enough to save everything to make sure nothing goes wrong.
* In the main DNA Scanner Access Console screen, click "Buffer Menu". This is your buffer screen. You will notice there are THREE buffers there. More than enough. Each buffer contains an UI, an UE, and an SE. For your work, you will only ever bother with the SE part.
* To save your work into a buffer, once your pod is occupied, simply click Save to Buffer. This will save the test subject's Unique Enzymes, Unique Identifiers, and Structural Enzymes. What you saved is now backed up by the console, and, if not overwritten, is now safe. You can relabel the buffer to make sure of what it is. For instance, calling your original test subject's SE something like "Clean Backup", or calling an SE that has Hulk isolated something like "Hulk". Simple, but very helpful to not get lost.
* You can transfer a buffer's content into the pod's occupant, making it easier to transfer research data between subjects. Just stick a test subject in there, click Buffers, as usual, then click "Occupant", right after "Transfer To:".
* By using the "Occupant - Delayed" button, the scanner will apply the buffer's content onto the next person who enters the scanner. This is mainly useful for self-experimenting.
* Make use of all three buffers. Assuming you have a human with clean SEs inside your pod, you can save his SE in the first buffer, and name it "Clean Backup". At this point, experiment on one block at a time, saving it on the second buffer, and roll back to the Clean Backup if it's a bad mutation. Once you find a power, save it on the third buffer, and use that as your new Clean Backup.
* You can use Datadisks to backup your work as well! With one in your hand, click the DNA Scanner Access Console. Now enter the Buffer screen. Click "Save To" in there to save the data to the diskette. From the main screen, you can eject the disk from the console. You can also load data from a diskette much the same way. Except you click in "Load From" in the buffer screen, instead of "Save To".
That covers buffers. But "what are DNA Injectors?" you may ask yourself. Well, injectors are tiny one-shot needles, that contain buffer data, whatever it may be. That means you can now turn that sweet, sweet Hulk buffer into a small, awesome, orange/red injector! Good stuff. To turn a buffer into an injector, simply click "Injector" in the options below the buffer in question, after "Transfer To:". A small needle will spawn on top of the DNA Scanner Access Console. You can now stick this baby in anyone who stands around for enough time. It's important to note that unlike using the scanner, injectors have a 100% chance to activate power blocks, but have a limited duration; this is true of both SE and UI/UE injectors. If you want permanent powers, you need to activate them with the scanner.
The DNA Scanner Access Console takes ten seconds to recharge after producing an injector.
Because of injectors, Geneticists are usually asked to give people superpowers, often by people who should not have those superpowers. This is best judged by the Research Director, who is in charge of the research. If you want to be like Marvel and give everyone superpowers, be ready for Security Officers knocking on your door because nothing gets the ship down like a herd of assistants with Hulk. So be ready to say "no" a lot. Usually the Geneticists are allowed to have powers, but note that if you run around the station while being a hulk, you're probably going to get a lot of attention from security and be the prime suspect if (when) anything happens. Don't go on a killing/destroying rampage if you're a hulk -- unless you're dealing with boarders, then security may turn a blind eye to what 'unfortunately' happened to those pirates who thought they could loot Genetics.
Note: If people inject themselves with a needle they found lying around that says "Godhood" on it without even asking what is in it, you will NOT get punished for turning them into monkeys. Wink wink. Just make sure to answer truthfully if asked, and not to inject it yourself. If people are stupid enough to inject themselves with unknown content, let them.
=== Manhandling Genes! ===
This guide here shows you step by step how to find the powers from the mysterious blocks!
Genes are distorted and twisted by shooting them with radiation. This can be done with the DNA Scanner Access Console and the computer in your lab.
== First Steps ==
This guide will start with using a monkey, because they're in the pen for a reason.
* Start by taking a monkey from the pen.
* Shove them into a DNA Scanner next to the pen.
* Check the computer next to it, and you'll see a bunch of information. Find "Structural Enzymes" and try to not confuse them with the other enzyme blocks above.
At the start of the shift no one has any idea which structural block is which. They're all randomized to keep things interesting. This is why we must experiment!
== Humanizing a Monkey + Making a 'Clean SE' ==
Changing the monkey into a human should be the first thing you do, because it is by far the easiest block to spot! It's probably the only one with a value higher than 800.
* Remember the species block so you don't waste time later trying to activate it.
* Decide whether you're going to go from lower blocks to higher blocks or vice versa. If you're working with a fellow Geneticist, decide together and start working at opposite ends to maximize efficiency. Remember to share data with your fellow Geneticist! When working with a partner, communication is key to efficient work.
* Change your radiation emitter settings to something a little more potent so changes will actually happen. Changing the Output Level up to 8 and Pulse Duration to 5 works fine.
* Click on the species-block's first (leftmost) character to administer radiation to it and hope it changes for the better! Repeat this step until the first value on the block is lower than 8. Keep the block below 800 for human, and above 800 for monkey.
* When you get it, you'll see the name on the top has changed from "monkey" to a randomly generated name. Congratulations, you've got your very own monkey-person!
* You'll now need to save the now pure DNA of your subject. On the computer, go to the "Buffer Menu" tab, then press the "Save to Buffer" button. It's also recommended to rename the label to make its function clear. This buffer now serves you as a "savepoint" which you can come back after an experimentation, making the research faster.
#If for any reason you've lost your clean SE and need to clean your DNA, you have mutadone pills in your lab. They'll completely restore your DNA, but they will also remove your powers. They are also an alternate way of turning a monkey into a human.
==== How Mutations Work ====
* Disabilities manifest if the block is over 800.
* Power manifesting is a little more complicated. It has an extra randomness added to the random! First off, to be eligible for activation their block must be over C00. After that, every time the subject's DNA is updated (either by re-applying the buffer or by pulsing radiation) the power has a chance to manifest. After it has manifested, it won't disappear unless the block goes below C00.
* Telekinesis: '''20% chance to activate.'''
* Hulk: '''15% chance to activate.'''
* Cold Resistance: '''25% chance to activate.'''
* X-Ray Vision: '''25% chance to activate.'''
* Chameleon: '''20% chance to activate.'''
* Dwarfism: '''15% chance to activate.''' For some reason this is a power on the same level as hulk.
Remember that this applies only to mutating via scanner: injectors always manifest powers, if their block is above C00, but the effects are temporary.
==== Manifesting Mutations ====
Back to business! Now we'll try to make a mutation show itself to us:
* Raise a '''new block to over 800''', preferably over '''C00''' and hope something manifests.
# Make sure it is the '''ONLY block''' over 800, otherwise you might get it mixed up with some other block's symptoms.
# Save the SE in a new buffer, then remove the monkey-man.
# Press '''Occupant - Delayed''' on your newly created buffer, get into the scanner and close the door. It will apply the buffer to you. '''Be sure to have a Clean SE saved in another buffer'''.
## If you get a red message, it's a disability! None of them will kill you, but they can be really annoying. To remove them, simply apply the Clean SE. Do it to the monkey-man as well, and pass onto the next block.
## If you get a blue message, you were lucky and manifested a power! Put the monkey-man back in and save his DNA in a separate buffer, where you'll keep all your powers. When undoing disabilities,use this new buffer instead of the clean one, and you'll keep your powers.
## If you get no message, you hit a power block but it did not manifest. Keep irradiating it until it gets over C00, then save it into your third buffer. Even if not manifested right now, you can always spam the third buffer until it actually does manifest; but since it heavily irradiates you, it's best to wait until you found all the powers. If you want to know which power you found, create yourself an injector.
# Applying buffers heavily irradiates the user. This will cause some toxin damage over time and, if overdone, can cause it to collapse for a few seconds. Every once in a while, take some antitoxin from your locker or a medbay vendor.
# When you collect all six powers, just apply the buffer to yourself until you manifest the missing ones; if there are some you don't want, like hulk or dwarfism, manually reduce its block's value below C00, save it on a second buffer, and apply it to yourself.
==== Against the Radiation ====
All that radiation pulsing is not healthy.
* At some point it may be a good idea to visit '''[[Chemistry]]''' and order some '''[[Potassium Iodide]]''' for your genetic testing. It's a very useful chem, as it lowers radiation levels quickly.
* '''[[Anti-Toxin]]''' or '''[[Charcoal]]''' can cure the toxin damage caused by radiation, but does little to the rads themselves.
* '''Rejuvenators''' can be injected through the DNA Scanner Access Console. The rejuvenating chem is '''Potassium Iodide'''.
* If your hair falls out, use a mirror to restore it. You can find one in medbay or in the toilets.
==== What to do with your powers ====
* Save your power buffer in a disk, as a backup. There's always the risk of someone overwriting them for random reasons.
* Bringing a couple of injectors with full powers to R&D will be greatly appreciated, as they give a hard to obtain kind of research.
* Make injectors to give to the greytideheads of staff or security. You can also offer permanent powers to
anyone who trusts you enough to not lock them in the scanner.
* Enjoy being the peak of human evolution! Use your powers for the greater good, or to make security's life hell by breaking down walls to high security areas and by being unstunnable. Remember that hulks are nonhuman to the AI, though, and that when security can't stun someone they'll pass directly to lethals.
Congratulations. If you read everything is this guide, you should now be a full-fledged Geneticist! Welcome to the club, friend, hope you enjoy it! Pass on the knowledge to those in need.
== The Gene Genie - The Traitorous Geneticist ==
Sorry for the bad chapter title. I wanted to use that for a very long time.
So, you learned how to do your job successfully, and how to be a credit to the station. You learned how to manipulate genes. Now you want to learn what the hell to do when the syndicate is the one writing your checks! Well, fret not! I will give you some pointers. But these are mostly tips - traitorous objectives differ wildly, and change your actions way too much for me to write a real guide on it.
=== Rev head ===
Simple. Flash colleagues. If the RD or the CMO come check on you, say you have a good set of powers, but the replicator is offline. Ask for him / her to strip and get in the Scanner. Lock him/her in, have your way with them, they can't leave nor can they talk. Let them enjoy their slow, painful death. If someone wants to clone the captain, that too is pretty simple. Just don't do it. As soon as the guy leaves, stuff the captain in a locker, take his stuff and call it a day. You could also eat until you get fat, transform people into monkeys and eat them. Fun for all.
Another fun strategy is, if you managed to kill a head of staff, to copy their identity with a DNA scanner and apply it to yourself; impersonating a head of staff during a revolution is easy since they are usually exempt from implanting.
=== Traitor ===
Depends on your objective. If it's a hard one, like stealing the AI... well, you're fucked. Keep working on those powers! As soon as you have Hulk + TK, go for it as you wish. No tips here.
If your objective is a simple one, though, like stealing the hand tele, there are more approaches to this. As the above tip, you can just break the walls with TK Hulk, but that is rather crass. There's a more roundabout, but classier way to tackle this. Take a monkey from the pen, transform it in a human. Take it's UI+UEs, make an injector, stuff it in your pocket with a label like "Clean Backup - Alexa White".
Now get your own UI+UEs and name it "Clean Backup - Original" or something. Avoid using your name. Now, go hide somewhere close to the item's location, stick yourself with the monkey injector, spawn emag, stick ID and PDA in your backpack. For added stealth, get a different outfit. Emag your way to the captain's room, get his jumpsuit, RUN RUN RUN. The AI might see you, so it would also be good if you spawned an agent card so you can't be tracked. If anyone sees you, they're not going to see your actual name, only the humanized monkey's name. Hide, stick yourself with your own stuff, change clothes, walk away smoothly.
If you have to kill someone, same stuff from rev.
Also, never forget identity theft. Since you can take someone's complete identity, including looks, you can have some fun with that.
=== Wizard ===
Well... Stealth wizard? Several things you can do, mostly involving UI+UE stuff. Not worth it, really. One thing you can do is taking identities and belongings, but you have to expose yourself to mess with the console. Your choice.
=== Changeling ===
REJOICE, your work is practically done for you! Have fun eating the lifeless corpses you clone. Keep in mind that transformations and transformation stings copy SE as well as the UI+UE. Turn people into horribly disabled freaks, or channel a lot of hulk-TK-xray-cold resisting supermen if you feel particularly benevolent.
https://wiki.yogstation.net/wiki/Guide_to_Genetics
Guide to Genetics
Jump to navigationJump to search
GeneTek Console
Geneticists have access to GeneTek consoles and scanners. These devices can, with enough patience, reward you with superpowers, crippling disabilities, or just amusing Mutations.
Contents
1 GeneTek Console
1.1 Research Menu
1.2 Equipment Cooldowns
1.3 Scanner Occupant
2 Research Materials
3 Potential
4 DNA Activators
5 Sequencing
5.1 Walkthrough - Sequencing Mutations
5.1.1 Unlocking locked base pairs
6 Injectors
7 Genetics Booth
8 Mutations
8.1 Stability
8.2 Mutually Exclusive Genes
8.3 Mutation List
8.4 Body Type Mutations
8.5 Booster Gene
8.6 High Complexity DNA
9 Chromosomes
10 Research
11 Combining Mutations
12 Lesser-Relevant Menus
12.1 Mutations Menu
12.2 Body
12.3 Appearance
13 Supplementary Video
GeneTek Console
DNAConsole.png CloningMachineScannerOffV2-32x32.gif GeneTek console and GeneTek scanner are machines that help Geneticists activate Mutations. Click the GeneTek console to start.
Research Menu
When you click Research Menu the GeneTek console will show:
Purchase Additional Materials - Where you buy Research Materials using the Research Budget.
Available Research - Shows Research.
Research in Progress - Shows how many seconds until Research or Unknown Mutation research finishes.
Researched Mutations - Shows researched Mutations.
Stored Mutations - Shows Stored Mutations.
Stored Chromosomes - Shows stored Chromosomes.
View DNA Samples - Lists crew member Potential Mutations.
Finished Research - Lists finished Research.
Equipment Cooldowns
After the GeneTek console is upgraded through Research it will show:
Analyzer - Gene Sequence Checker cooldown.
Emitter - Radiation Emitters cooldown.
Reclaimer - DNA Reclaimer cooldown.
Activators/Injectors - DNA Activator or DNA Injector creation cooldown. Injectors have twice the cooldown of Activators!
All cooldowns are measured in seconds.
Scanner Occupant
When the GeneTek scanner is occupied, the GeneTek console:
Health - Shows occupant's health.
Stability - Shows occupant's Stability.
Potential - Where you Scramble DNA and view, research, sequence, activate and reclaim Mutations.
Mutations - Lists occupant's activate Mutations.
Appearance - Change occupant's skin tone, eye color and top, middle and bottom details.
Body - Change occupant's Body Type Mutations.
To insert an occupant:
Click them with Grab intent and click on the GeneTek scanner.
Drag and drop their sprite onto the GeneTek scanner sprite.
To eject an occupant:
Right click on the GeneTek scanner and choose Eject Occupant.
Drag and drop the GeneTek scanner sprite onto the floor.
To lock an occupant inside the GeneTek scanner right click on the GeneTek scanner and choose Scanner Lock. The occupant can sometimes break out by flipping (R). To unlock the GeneTek scanner click Scanner Lock again.
There is a finite amount of air in the GeneTek scanner, so it is possible but unlikely for occupants to suffocate.
Research Materials
Research Materials are a currency shared by all GeneTek consoles.
You gain Research Materials:
Passively, 1 every few seconds; you can increase the gain up to 3 if you enable Advanced Genetic Analysis on up to two cloners.
40 for putting a filled DNA Activator into a GeneTek console.
1 for every 50 credits spent from the Research Budget through the Purchase Additional Materials.
You spend Research Materials on:
Research.
Researching Unknown Mutations.
Creating DNA Injectors.
Selling Mutations at the Gene Booth.
Potential
Unknown mutation.png
Every organism has Potential, Unknown Mutations, incomplete and inactive. Potential Mutations are randomized each round, but within a round, they will always be the same, even after death. Only changing identity via stable mutagen or DNA Scrambler can change it. The overarching goal of genetics is to research and activate Potential Mutations among the crew.
View the crew's Unknown Mutations through View DNA Samples or insert an occupant into the GeneTek scanner and click Potential. To research an Unknown Mutation select it and click Research required. After several seconds the research will finish. Each Unknown Mutation only needs to be researched once. The base cost of researching Unknown Mutation is 20 Research Materials.
To activate the Mutation either:
Create a DNA Activator and inject it into the subject.
Sequence the Mutation and activate it.
When you activate the Potential Mutation of a crew member or player-controlled monkey you are rewarded with:
40 Research Materials.
2 auto-decryptors for Unlocking locked base pairs.
2-5 random Chromosomes.
Reduced Research and Unknown Mutation research cost.
Activating a Mutation on an NPC human or monkey will not give you the above rewards, though the Mutation will still work as normal.
DNA Activators
Known mutation.png Sequenced mutation.png DNA Activators activate organism's Potential Mutations. You can Create Activator every 20 seconds.
You can Create Activators from menus:
Researched Mutations
Stored Mutation
View DNA Samples
Potential
Mutations
If a DNA Activator activates a crew member's Potential Mutation the DNA Activator will turn transparent and become a filled DNA Activator (DNAActivatorFilledV3.png). Click on the GeneTek console with the filled DNA Activator in your active hand to put it in and receive the rewards. If the DNA Activator did not activate a crew member's Potential Mutation, you'll get a useless expended DNA Activator (ExpendedActivatorV2.png).
Sequencing
After you Sequence a Mutation, you can activate a Potential Mutation immediately, without cooldown. To Sequence a Mutation you need to find the missing base pairs. You only need to Sequence each Mutation once. Next time you see the same Mutation, an Autocomplete button will appear. Press it to Sequence the Mutation immediately.
Mutations are composed of base pairs. Bases are represented as letters G, A, C or T (Guanine, Adenine, Cytosine or Thymine). Bases always come in pair. G is always paired with C and base T is always paired up with base A.
You can only Sequence Mutations of GeneTek scanner occupants.
Walkthrough - Sequencing Mutations
Mutation with an unknown Sequence.
First, insert an occupant into the GeneTek scanner. Then, select a Mutation you want to Sequence. You don't have to research the Mutation before Sequencing it.
Filling up half-filled base pairs.
Start off by filling up any half-filled base pairs. A goes with T, G goes with C. ?-G becomes C-G, ?-T turns to A-T and A-? becomes A-T.
Filling up unfilled base pairs.
Next, start working on the unfilled base pairs. G-C is different from C-G, and T-A is different from A-T, so each unfilled base pair has four different possible arrangements. Let's try G-C first and work down the list.
Check Stability shows the guess is incorrect.
With a Gene Sequence Checker you can fill out base pairs, click Check Stability and see if your guess is correct. If the base pairs are correct, they will turn green. If they are wrong they will turn red. Make another base pair guess, wait until Check Stability cools down and see if your guess is correct this time.
If you do not have the Gene Sequence Checker Research, you can make the guesses manually by going through all the sixteen base pair permutations. If you have one person with half of the code for the Mutation and another has the other half, you can compare the two and deduce the complete code, or at least part of it.
Correct guess, but a base pair is locked.
After correctly guessing base pairs it is time to unlock the locked base pair.
Unlocking locked base pairs
Notice a little lock? Click on it to begin a game:
SCANNER ALERT: Encryption is a 2-character code.
Possible characters in this code: G C
1 auto-decryptions available. Enter UNLOCK as the code to expend one.
If you don't want to play the game, you can type "unlock" and auto-decrypt the lock. You gain 2 auto-decryptors after activating a Mutation on a crew member.
Alternately, a specific chain of letters must be entered to unlock the pair of bases. The only possible combinations here are GG, GC, CG and CC.
If your answer is wrong, the machine will show you how close you are to the correct answer. Let's assume we entered GG and this was the result:
SCANNER ALERT: Decryption failed.
0/2 correct characters in entered code.
0/2 characters in correct position.
Attempts remaining: 1.
Unlocked and correct!
This shows that there is no G in the code, and thus the code must be CC!
Some codes will be this simple, but others will have up to 4 characters. Some genes will even have multiple locked pairs. Most of the more powerful genes have some of their pairs locked, so it can be worth the effort!
Success! Click Activate and to activate the Mutation!
Injectors
Completing the DNA Injectors research allows the creation of DNA Injectors . When you inject an organism with a DNA Injector they will gain the Mutation even if it was not in their Potential Mutations. However, these do not give any Chromosomes, Research Materials, or auto-decryptors as rewards. It is also important to note DNA Injectors change the organism's Stability!
To make an Injector, pick Create Injector from either Stored Mutations or occupant's Mutations. This can be done every 40 seconds for 40 Research Materials. They share a cooldown timer with Activators, so creating a Injector also prevents you from making an Activator and vice versa.
DNA Injectors are administered similarly to DNA Activators, i.e. you click on the subject while you're holding the Injector to use it on them (The subject can also use it on themselves.) Using one always creates a "filled injector"; these do not give any rewards when redeemed, and it is not possible to make them do so.
Genetics Booth
Once the relevant upgrade is researched, it is also possible to grant Mutations through the Gene Booth (also known as the Genetics Booth), a machine that grants Mutations in exchange for money. Through the Gene Booth, you can share Mutations without having to stray from the console.
When you access an occupant's Mutations or Stored Mutations and click on a Mutation, you can choose Sell at Gene Booth to send 5 applications of the Mutation to the Gene Booth for 30 Research Materials. It'll prompt you to set a price in credits and a description. It is possible to sell Mutations spliced with Chromosomes, and genes in the booth can be locked or have their price adjusted by swiping a Captain, Medical Director, or Head of Security ID on the booth.
Similar to Injectors, the Gene Booth can give Mutations not in the recipient's Potential. Receiving a Mutation through the Gene Booth changes their Stability. Because of this, it is common practice to splice Mutations with Stabilizer Chromosomes to nullify the Stability change.
Gene Booth sales go towards the Research budget. You can swipe your ID card on the GeneTek console to siphon a portion of the proceeds to your own account.
Mutations
Dnahotbar.png
When you activate a Potential Mutation it becomes an active Mutation. There are a wide variety of Mutations, some commonplace and simple, some extremely powerful and rare. Some are beneficial, some are detrimental, some are situational, and some are just wacky and fun. There are more mutations than those listed here, so feel free to sequence and find Mutations on your own!
When you die you lose all your Mutations, but keep your Potential Mutations. For the cloner in particular, you can also enable the Advanced Genetic Analysis option, so clones keep Mutations they had when they were scanned; this is especially handy for those trying to stick with a certain Body Type Mutation.
Clicking the blue ABIL tab on your hotbar will toggle between standard options and your available Mutation powers.
Mutations are different from Traits.
Stability
Debilitating Mutations often increase Stability while beneficial Mutations decrease it. Gaining a Mutation that was already in your Potential causes no Stability loss or gain, e.g. getting Mutations through the Gene Booth and DNA Injectors can change Stability, while getting them via DNA Activators does not.
Stability determines how often your Mutation powers will work as intended. Every organism starts with 125 Stability. At 100 Stability your Mutation powers will work correctly 100% of the time. At 40 Stability your Mutation powers will work correctly 40% of the time.
Low Stability causes your Mutation powers to backfire or even degrade into their opposite Mutations. For example, Toxic Resistance degrades into Blood Toxification, while Optic Energizer burns your eyes instead of firing lasers. Having Stability below 50 also garbles your speech, replacing some letters with g's, u's, l's, and b's, and instead of "[name] says [text]", it's "[name] gurgles [text]".
Mutually Exclusive Genes
Some genes belong to 'groups'. For each of these groups, you can only have one gene from that group at once. If you already have a gene from a particular group and another gene from that group is added to you, the new gene will replace the old one.
All mutantraces, or body type mutations, are exclusive with each other.
Group Mutations
Thermal Modifiers Thermal Resistance, Heat resistance, Cold Resistance, Thermal Vulnerability
Toxin Modifiers Toxic Resistance, Blood Toxification
Radiation Modifiers Radioactive, Radiation Resistance
Blood Modifiers Hemopoesis Overdrive, Polycythemia, Anemia
Regenerations Regeneration, Super Regeneration, Lupine Regeneration
Fitness Physically Fit, Physically Unfit
Mutation List
For a more complete mutation list, see the dedicated page on Genetic Mutations.
Mutation Message Danger Level Stability Effect Empowered Effect
Blindness You can't see anything. Harmful +20 You no longer see action messages about what you and other people are doing and cannot see anything beyond a very small distance from you. You can still interact with things via right-click menu, and you can click on pills/patches/auto-injectors in-hand to use them on yourself, but you otherwise can't do much. To fix this without modifying DNA, you can equip a pair of VISOR Goggles. No change.
Frontal Gyrus Suspension You are unable to express yourself. Harmful +20 You become mute. You are unable to speak, and every attempt at talking just gives you the message "You seem to be unable to speak." The *scream emote (Hotkey: Ctrl + S) no longer makes sound and instead does one of a random set of unique messages describing how you have no voice and must scream. The Mime gimmick job starts with an irremovable version of this, as an enforced vow of silence. No change.
Deafness It's quiet. Too quiet. Harmful +20 You can't hear anything and are immune to most forms of ear damage. Blessed silence may come as a relief once you've gotten sick of the regular radio chatter. To fix this without modifying DNA, you can equip an auditory headset. No change.
Radioactive You feel a strange sickness permeate your whole body Harmful -10 You suffer from radiation sickness and cause the same to nearby people. May also give you more bad mutations. No change.
Dyspraxia You feel kind of off-balance and disoriented. Harmful +10 In short, you're clumsy. Several actions have a flat chance to comically backfire, often harming you or causing extra damage. For example, you might accidentally start cuffing yourself when cuffing others, jab yourself while using a fork, and shoot yourself when firing a gun. Conducting surgery and handling grenades and guns become particularly dangerous. One upside: this lets you put crayons in clown shoes to crayon-walk!
The Clown spawns with a variant of this mutation that cannot be cured. Different from the "Dyspraxia" caused by the Wizard spell Clown's Revenge.
No change.
Glowy Your skin begins to glow softly. Harmless 0 You permanently emit a light with a random color and intensity. No change.
Frontal Gyrus Alteration Type N Y-you f.. feel a.. a bit n-n-nervous. Porky but Harmless 0 Your speech stutters and falters like Porky the Pig. No change.
Frontal Gyrus Alteration Type-S You feel like you want to smile and smile and smile forever :) Happily Harmless 0 You somehow say colon parthesis (:)) after everything you say. No change.
Frontal Gyrus Alteration Type-E You feel funky. Elvisously Harmless 0 You talk like a king...a king of rock and roll! You extend your vowels the same way Elvis does. No change.
Frontal Gyrus Alteration Type-C Ye feel like a reet prat like, innit? Hermless, mate 0 You speak like a middle-class English chav. You are the charmingly ugly lovechild of at least ten cultural accents and pack sounds together like black pudding. No change.
Frontal Gyrus Alteration Type-B You feel Swedish, however that works. Tootelly Hermless, bork bork! 0 You speak not like an actual Swede, but the Swedish Chef, Bork Bork Bork! You extend your vowels to long e's and o's, and randomly add "Bork"'s like you add Swedish meatballs. Fun historical fact: the chef used to have a 20% chance to spawn with this accent. No change.
Frontal Gyrus Alteration Type-T You feel torn apart! Moestly Hahwleess 0 You have Tommy Wiseau's Joisey accent. Your speech is an audio disaster. No change.
Frontal Gyrus Alteration Type-CS You feel great!! Comically Harmless 0 You somehow speak in Comic Sans. No change.
Frontal Gyrus Alteration Type-D You feel like your tongue's made out of lead. Compleffely Harmleshsh 0 You slur your speech like a drunkard. No change.
Frontal Gyrus Alteration Type-R .sdrawkcab tib a leef uoY .sselmrah, tub gnisufnoC 0 You talk backwards. Pro-tip: Put your ; or :prefix at the end to talk over the radio. No change.
Frontal Gyrus Alteration Type-O You feel a bit tongue-tied. Mstly Hrmlss 0 All your vowels get replaced with a random vowel. No change.
Frontal Gyrus Alteration Type-F Och aye! You feel like a true Scot! Skaithless 0 You speak with a Scottish accent. You do weird things with vowels, and, unlike other accents, you use entirely different words for things. You call a butt a "dowp", a jumpsuit a "carsakie", things like that. No change.
Frontal Gyrus Alteration Type-FI Sauna and birch beatings! Hyvä! Arrmless 0 You speak like the space Finns, the sauna-loving, people-hating neighbors of Sweden. You double up on your i's and r's, pronounce g-vowel pairs at the beginning of words as k-vowel, chop w's into v's, have a peculiar inability to say h's, say sh as ch, and switch up your b's with p's and vice versa. No change.
Frontal Gyrus Alteration Type-Q You feel that your province is a nation, however that works. 'armless 0 You speak the accent of the space separatist Space Quebeckers of Space Canada. You say "le" instead of "the", contract h's at the beginning of words, and pepper your sentences with curious profanity. In addition to the stereotypical "th"->"z", you also have:
ts->zes
st->ss
ch->sh
tion->sion
vowel-t at end of word->vowel-tte
vowels at the beginning of a word->h-vowel
f at beginning or end of word->ef
No change.
Frontal Gyrus Alteration Type-Y You feel like you're on Ilkley Moor without a hat. 'armless 0 You speak with the somewhat impenetrable Tyke accent of the Space Yorkies of Space England. Similar to the Scottish accent, you have a different vocabulary, e.g. "arse" for "butt", "gaffer" for "captain", "tha" for "you", "t'" for "the", and many more. You chop off the "g" in "ng", drop the "h" from beginnning of words, transform "ight" to "eet", and a bunch more:
ay->ey
ade->ed
ave->ev
ea->eea
d, t, f & th at end of word->sometimes contracted to '
i->ah when alone or an e comes two letters later
it at the start of a sentence->'t
ou/ow->ah
oar->ooar
oa->oi
oot & ool->ooit & ooil
ole->oil
ough->ow
In short, you might not think it's English, but it is. You can fault the Space Danes and their Space Viking raids of the past for this one.
No change.
Frontal Gyrus Alteration Type-BT Your breath smells like a fart. Butt +10 You speak like a buttbot. When you talk, some of your words are replaced by "butt". No change.
Frontal Gyrus Alteration Type-SD You feel like you've got some work to do now. Harmful 0 You speak like Scooby-Doo, a talking dog from the children's mystery cartoon franchise Scooby-Doo. In short, lots and lots of R's. Like Scots, you also have a different vocabulary, which mechanics-wise means you replace some words with different ones. For example, instead of AI, you say "rehrhai". Werewolves have this when transformed. No change.
Frontal Gyrus Alteration Type-X You can't seem to form any coherent thoughts! Harmful +10 Your speech becomes unintelligible, as every consonant is randomized. Vowels are unaffected. No change.
Hemochromia Type-U You feel like you're out of breath. Harmless 0 A volatile mutation with 12 known stable alternatives. Will quickly break down into one of them if you exit the scanner. No change.
Hemochromia Type-R You feel a bit less soft. Beneficial 0 Your blood takes on a scarlet coloration. You also regenerate 2 more units of blood per second while there's less than 500 units of it in you. No change.
Hemochromia Type-B You feel a bit less soft. Beneficial 0 Your blood takes on a copper coloration. You also regenerate 2 more units of blood per second while there's less than 500 units of it in you. No change.
Hemochromia Type-G You feel a bit less soft. Beneficial 0 Your blood takes on a brass coloration. You also regenerate 2 more units of blood per second while there's less than 500 units of it in you. No change.
Hemochromia Type-L You feel a bit less soft. Beneficial 0 Your blood takes on a chartreuse coloration. You also regenerate 2 more units of blood per second while there's less than 500 units of it in you. No change.
Hemochromia Type-O You feel a bit less soft. Beneficial 0 Your blood takes on a verdant coloration. You also regenerate 2 more units of blood per second while there's less than 500 units of it in you. No change.
Hemochromia Type-J You feel a bit less soft. Beneficial 0 Your blood takes on a emerald coloration. You also regenerate 2 more units of blood per second while there's less than 500 units of it in you. No change.
Hemochromia Type-T You feel a bit less soft. Beneficial 0 Your blood takes on a cyan coloration. You also regenerate 2 more units of blood per second while there's less than 500 units of it in you. No change.
Hemochromia Type-C You feel a bit less soft. Beneficial 0 Your blood takes on a cerulean coloration. You also regenerate 2 more units of blood per second while there's less than 500 units of it in you. No change.
Hemochromia Type-I You feel a bit less soft. Beneficial 0 Your blood takes on a azure coloration. You also regenerate 2 more units of blood per second while there's less than 500 units of it in you. No change.
Hemochromia Type-P You feel a bit less soft. Beneficial 0 Your blood takes on a lavander coloration. You also regenerate 2 more units of blood per second while there's less than 500 units of it in you. No change.
Hemochromia Type-V You feel a bit less soft. Beneficial 0 Your blood takes on a plum coloration. You also regenerate 2 more units of blood per second while there's less than 500 units of it in you. No change.
Hemochromia Type-F You feel a bit less soft. Beneficial 0 Your blood takes on a magenta coloration. You also regenerate 2 more units of blood per second while there's less than 500 units of it in you. No change.
Achromia N/A Harmless 0 Your skin becomes completely grayscale. No change.
Noir You feel chromatic pain. Beneficial 0 Your whole body, including any held and worn items, become completely grayscale. Anyone joining as Mime has a 20% chance to spawn with this mutation, and it cannot be removed. No change.
Yee Yee Nee. 0 Makes all your words into "yee". It is only available through yee reagent and admin shenanigans; you cannot find this in the genepools of monkeys, humans, and other carbon-based life-forms. No change.
Cranial Keratin Formation A pair of horns erupt from your head. Harmless 0 You look (more) like a doofus. No change.
Apocrine Enhancement You feel sweaty. Harmless 0 You get a serious case of the stinks, causing people nearby to get wonderful messages about how nice the room smells. No change.
Fire Resistance You feel cold. Beneficial -10 You are immune to fires and atmospheric heat. You gain a 50% resistance to all BURN damage.
Cold Resistance You feel warm. Beneficial -10 You are immune to low temperature and ice. While your body temperature can still drop to freezing and below (allowing you still benefit from cryoxadone), you won't be slowed down. You have a noticeable blue aura. You are additionally immune to slipping on ice.
Thermal Resistance N/A Beneficial -10 You gain a 50% resistance to heat and cold. You gain the full fire immunity of fire resistance and the full cold immunity of cold resistance
Alcohol resistance You feel unusually sober. Beneficial 0 You do not suffer most of the effects of alcohol, e.g. the blurred vision and mistepping, though you'll still have drunkenly slurred speech. You can also drink Bo Jack Daniel's without passing out. At the start of the round, the Detective, Head of Security, and Bartender get the Professional Drinker trait, which gives them this mutation. You can shoot with full accuracy regardless of how drunk you are.
Radiation Resistance N/A Beneficial -15 You gain a 75% resistance against radiation. You are immune to ionizing radiation, period. While you'll still get the Irradiated status effect, you don't suffer the resulting mutations or the associated TOX and BRUTE (in the case of neutron radiation) damage.
SMES Human Your hair stands on end. Beneficial (Mostly) -15 You are protected from electrical energy. Useful when the AI is shocking everything or a malicious Engineer has hotwired the engine and you are lacking insulated gloves. This also prevents you from gaining a magnetic field in the Bio-Magnetic Field event. You also gain 40% disorient resistance, making you more difficult to stun.
Jumpy Your leg muscles feel strong and taut. Beneficial -10 You gain a jump that moves you half a screen in no time at all. Just make sure you don't use it while inside a container/vehicle of some sort, or you won't like the result... You jump much farther.
Chameleon You feel at one with your surroundings. Beneficial -15 When toggled on, you become invisible while standing still ; you'll know you've become invisible because you'll see a faint light blue aura around you. The AI, Cyborgs, people wearing optical thermal scanners, and people with X-Ray Vision can still see you. This can work against you in more ways than one. No change.
Cloak of Darkness You meld into the shadows. Beneficial -15 Activate this ability, and now you're invisible while in the dark. You can tell if it's dark enough if you have a dark grey aura around you; generally ill-lit maintenance sections and rooms where the lights are broken/have been turned off are dark enough to hide in. This does not work in Space or the Seafloor. The AI, Cyborgs, people wearing optical thermal scanners, and people with X-Ray Vision can still see you. Vampires get this power for their Bat Form Mk II ability. No change.
High-pressure intestines You feel bloated and gassy. Beneficial -15 Blow away your foes with your tremendous farts! You will not just blow away your foes, but also yourself. Using this on top of a bible sends you to a special "hell" area instead of gibbing you.
Cryokinesis You notice a strange cold tingle in your fingertips. Beneficial -10 You gain the ability to cool people down significantly by firing a ball of ice at them, and to get on everyone's nerves by creating patches of slippery ice on the floor. Your ice powers now effect a 3x3 area instead of a 1x1. The Discount Superhero Spooktober job can sometimes spawn with this variant.
Telepathy You can hear your own voice echoing in your mind. Beneficial 0 You gain the ability to communicate telepathically. Telepathic messages show up to the recipient as "A psychic voice echoes, "[TEXT]"" in hotpink. Don't use this to impersonate the admins. No change.
Optic Energizer Your eyes ache and burn. Beneficial -10 You gain an "Eyebeams" ability that fires laser beams from your eyes, even if there's something blocking your eyes (e.g. a blindfold). These are different from the ones used by energy guns and their ilk; these do only 20 BURN and only very slightly heat up objects they pass over (they can still ignite plasma though). The Discount Superhero Spooktober job has a chance to spawn with a nonlethal version that drains 80 Stamina, on par with a taser. Your eye beams now do 45 BURN and sound much more menacing.
Meta-Neural Enhancement Your mind feels closed. Beneficial 0 You cannot be mind-read or telepathically spoken to. Doesn't affect the admin's telepathy, obviously. You become immune to the psychic blasts of certain hostile space creatures.
Empathic Thought You suddenly notice more about others than you did before. Beneficial -5 You gain an ability that lets you read the minds of others, telling you a random thought of no significance and clues about their current intent (as in Disarm, Grab, etc., not necessarily the player's actual intent), current health, and their PIN number and other notes. No change.
Matter Eater You feel hungry. Beneficial -5 You can eat many more items than normal, like weapons from disarmed opponents, or even your own body parts! Just remember that you need certain body parts to live... You can eat one additional thing. In all of space.
Telekinetic Pull You feel your consciousness expand outwards. Beneficial -10 You can send unanchored items flying from afar by click-dragging them from one tile to another. You can also perform a Telekinetic Smash, which throws all unanchored objects near to a location into it. This doesn't work on items of "gigantic" size or larger, e.g. pianos, TTV bombs. Works great with X-ray vision. You throw more things when using the Smash ability.
Gamma Ray Exposure You feel your muscles swell to an immense size. Beneficial -25 Your skin turns green, and your punches knock people away from you and do more damage. Your fists can instantly break tables, asteroid rock, wooden doors (but not any other doors), and grilles if they've fairly low health, and they can break windows, unreinforced walls, and clown cars with enough time. You can pull corpses, people you've grabbed, people who aren't on Help intent, and things that contain either with no slowdown. Watch your health; if you get too hurt, your muscles will shrink back down. Your muscles no longer shrink when significantly damaged.
X-Ray vision You suddenly seem to be able to see through everything. Beneficial -20 Basically wearing Optical Meson Scanners, as it lets you can see through walls. Doesn't decrease or remove darkness, but it also doesn't increase the darkness of areas beyond your normal line of sight, unlike mesons. You additionally gain the power to see organics through walls, similar to wearing Optical Thermal Scanners, and see through the invisibilty cloak from cloaking devices, Chameleon, and Cloak of Darkness.
High Decay Digestion Your stomach grumbles unpleasantly. Harmful -10 Your farts create clouds of toxic gas, which turn into jenkem when inhaled by anyone without this gene. Your farts contain additional toxin. Gross.
Self Biomass Manipulation Your skin and joints feel loose. Harmful -5 You can turn yourself into a liquid that can phase through walls and other solid objects, sort of like a genetic version of the wizard's Phase Shift. If it doesn't have the Synchronized chromosome, your clothes won't come with you, so you come out naked; if it is Synchronized, they do! If it misfires due to insufficient stability, you drop a random clothing item you were wearing if it was Synchronized, and if it wasn't, you drop an random internal organ (not limbs or brain, but does include heart).
Note: This power used to trigger the unsynchronized effect if you were anywhere on the Restricted area, but now it simply states that "you cannot seem to turn incorporeal here.")
No change.
Incendiary Mitochondria You feel like you are burning up. Harmful -10 You set yourself on fire and become a human torch. This is a very bad thing if you don't want to burn alive. If you have Heat Resistance this will instead fizzle and do nothing. Larger fire, and it works with normal/empowered Heat Resistance.
Stupefaction You twitch. Harmful +10 You will occasionally be stunned for a few seconds and be knocked down to the floor. No change.
Chronic Cough You feel an irritating itch in your throat. Harmful 0 You occasionally cough, dropping anything in your hands. No change.
Diminished Optic Nerves Your vision blurs. Harmful +5 Your vision becomes blurred, and darkened outside a small radius. Can be counteracted with Prescription Glasses. No change.
Adrenaline Rush You feel hype! Beneficial -15 You get an activated ability that allows you to recover from stuns by putting various stimulating and painkilling drugs in your bloodstream. Also one of the only genetic mutations that can be used while incapacitated. You get double the drugs from each use.
Anaerobic Metabolism Your lungs feel strangely empty. Beneficial -30 Prevents you from taking any damage from lack of breathable atmosphere, essentially allowing you to breathe anywhere. You gain complete immunity to OXY damage and atmospheric gases. Note that you will still inhale and be touched by chemical smokes.
Apidae Metabolism You feel buzzed. Harmless 0 Doesn't seem to do anything at first. However, if sugar is put into the bloodstream through any means, it has...interesting effects. No change.
Constricted Larynx ...you feel like being quiet... Harmless 0 Your text becomes really, really small. No change.
Corprolalia You can't seem to shut up! Harmless 0 You randomly shout random swear words. No change.
Dactyl Crystalization Your fingers and toes turn transparent and crystalline. Harmless 0 Changes your snap and slap noises. This doesn't mean you can't still snap your fingers off! No change.
Dermal Glitter Your skin looks all blinged out. Harmless 0 You sparkle as if you're carrying an item made of gold. No change.
Dimensional Shift You begin to see a small blue light... Beneficial -15 You can enter a pocket dimension, rendering you immune to any and all outside events, but you're unable to move while within this space until you exit. Basically, an indestructible, incorporeal closet on command. Any effects that are doing damage to you such as a heart attack or damage from poison still happen. No change.
Ethanol Production You feel drunk! Harmful +5 You constantly produce ethanol in your bloodstream, slowly making you extremely drunk. No change.
Healing Touch Your hands radiate a comforting aura. Beneficial -10 You gain an ability that can heal an adjacent human for a small amount of damage. You heal twice as much on each use.
High-Pressure Larynx YOU SUDDENLY FEEL LIKE SHOUTING A WHOLE LOT!!! Harmless 0 YOUR TEXT BECOMES REALLY LARGE No change.
Irritable Bowels Your guts are rumbling. Harmless 0 You automatically and intermittently fart. No change.
Meta-Neural Antenna Your head is full of odd chatter. Beneficial -5 You can hear the general radio channel (145.9) without a headset. You can hear all radio channels without a headset. Or rather, almost all, since there some channels you still won't hear, namely the ones used by Conspirators, Gangsters, and Nuclear Operatives. The machinetalk used by AIs and Cyborgs are not radio channels, so this mutation doesn't give you access to it.
Midas Touch Your hands sparkle and gleam. Beneficial -5 You gain the ability to turn certain items into solid gold! This includes your own butt (and other limbs). Just don't expect to get super-rich from selling your transmuted gold bars; the traders can tell that it wasn't originally genuine gold. There's also a chance you're just turn items in flesh (Grody!) instead of gold; the less stability you have, the more likely this'll happen. You can also transmute large objects into gold- not walls or floors, but things like tables and chairs.
Motor Neuron Signal Enhancement One of your limbs feels a bit strange and twitchy. Harmful +25 A random limb, chosen upon mutation acquirement, proceeds to strangle you, kick you in the head, and do various other harmful actions. No effect.
Musculature Enhancement You feel buff! Beneficial -5 You gain a slight strength bonus to mining. Also negates the speed penalty from pulling objects somewhat. Maybe it has other uses... You feel less pain, being able to move as though you were 50 HP points healthier.
Narcolepsy You feel sleepy. Harmful +15 You randomly to fall asleep. No effect.
Natural Anti-Toxins Your pulse seems to relax. Beneficial -10 Increases the depletion rate of all chemicals in your bloodstream. Note that this is not exclusive to poisons; it affects all chemicals. Note: This mutation cannot be removed with mutadone Doubles the rate of chemical depletion.
Paranoia They're out to get you! Harmless 0 You automatically and intermittently scream. No effect.
Photokinesis Everything seems too dark! Beneficial 0 You can create a radiant point of light. The point of light is twice as bright and lasts twice as long.
Polymorphism You don't feel entirely like yourself somehow. Beneficial -15 You can take on the appearance and name of a crewmember by touching them. No effect.
Pseudonecrosis N/A Harmful -5 You are recognized as dead by all medical scanners and machinery. You appear visually dead when laying down. (This means anyone examining you will see *[Your name] is limp and unresponsive, a dull lifeless look in their eyes.*)
Regeneration Your skin feels tingly and shifty. Beneficial -25 Every few seconds, you slowly heal 1 BRUTE and 1 BURN and have a 0.4% chance to a regain a lost limb. If you are missing both a leg and arm, regeneration prioritizes the arms and won't regrow legs until you have two arms again. You heal twice as much, and have double the chance to regrow a lost limb.
Super Regeneration You begin to feel your flesh mending back together. Grody. Beneficial 0 Much better version of Regeneration as the name implies. It works in the same way, but it heals at an astonishing 7 BRUTE and 7 BURN every time and has a 2% chance to also regrow a limb. This does not show up in people's Potential naturally, and it cannot be removed by any means, barring Admin intervention. The only way to get this is to sign a certain demonic contract, where this powerful boon comes with an equally powerful curse... Doubled effects (but good luck getting it).
Lupine Regeneration You feel oddly feral. Beneficial 0 An extra-powerful form of Regeneration that Werewolves get in their Werewolf form. It functions exactly the same but the healing rate is 2 BRUTE and 2 BURN every few seconds and the chance to regrow limbs is now 2%. This cannot be removed from the Werewolf in any way except by transforming back into a human, i.e. no mutation storage, no mutadone, etc., and it normally cannot be found in people's Potential. If you somehow gain this mutation without being a Werewolf, you get lycanthropy. No effect (only a shameful wolf would do genetics).
Spatial Destabilization You feel a bit out of place. Harmful -10 You teleport at random. Fortunately you can't teleport onto space tiles. Unfortunately you can teleport onto things covering space tiles, like catwalks. No effect.
Toxic Resistance You feel refreshed and clean. Beneficial -30 You take 66% less TOX damage from all sources. You are completely immune to TOX damage.
Unstable Refraction N/A Harmful -15 You randomly flicker in and out of invisibility at random. (Unable to get currently) No effect.
Meta-Neural Haze N/A Harmful -5 Your character can't be examined unless the examiner is adjacent to you. Your character can't be examined at all.
Brown Note You feel mischievous! Harmless (Mostly) -15 You get a "Brown Note" ability that produces a sound that makes up to 7 people. Be careful around bibles! The sound is louder, making up to 10 people fart.
Mass Emesis You feel sick. Beneficial -10 You can expel whatever chemicals were in your bloodstream as a beam of vomit. Anyone caught in the beam absorbs the chems. Your vomit spew travels twice as far.
Ink Glands You feel artistic. Beneficial -2 You gain the ability to paint nearby people and objects a random color. No effect.
Fire Breath Your throat is burning! Beneficial -10 You can exhale fire. Your fire breath travels twice as far, and is 4x as hot.
Erebokinesis Everything seems too bright! Beneficial -15 You can snuff out all light in an area, akin to a darkness artifact. The field lasts twice as long, and its radius is doubled (meaning the area is quadrupled).
Mutagenic Field Your flesh begins to warp and contort weirdly! Harmful -35 You occasionally spontaneously mutate and may cause others nearby to do the same, with a higher chance of receiving bad mutations than good. No effect.
Blood Toxification You feel really sick... Harmful +20 You occasionally (10% chance every few seconds) suffer one unit of toxin damage. No effect.
Monkeyspeak You feel one with the jungle! Beneficial 0 You can understand the chimpering of monkeys. No effect.
Night Vision Everything suddenly appears oddly lit. Beneficial -15 Darkness is greatly reduced in an area around you. Pitch-black areas will still appear dim, though not enough to significantly reduce visibility. The area around you in which you can see in darkness is increased, allowing you to functionally see your entire screen even in pitch blackness.
Hemopoiesis Overdrive You feel like being stabbed isn't such a big deal anymore. Beneficial -5 When you have less than 500 units of blood in you, you regenerate blood faster than usual at around 4 units per second. Stacks with filgrastim's blood regen. Blood gain is doubled.
Tinnitus You hear a ringing in your ears. Harmful 0 Occasionally, you hear a ringing sound in your ears, similar to that of a phone ringing. It persists even if you are deaf. No effect.
Physically Unfit You feel slightly less energetic. Harmful +10 Your max stamina is reduced by 30, and your stamina regen is reduced by 2. No effect.
Physically Fit You feel slightly more energetic. Beneficial +5 Your max stamina is increased by 30, and your stamina regen is increased by 2. Stamina increases are doubled.
Nectar Perspiration Your guts are rumbling Harmful +10 A swarm of tiny lil' bees surrounds you. These bees sometimes sting you at any time, giving you histamine. Wearing either an apiculturist's suit or hood halves the chance of getting stung by your own bees; wearing both prevents it entirely. Otherwise, wearing armor (or any other form of protection) does not prevent from being stung. Sadly, the bees can't sting others. No effect.
Electromagnetic Field None. Harmful +10 Tiny, 1 tile, EMP bursts occasionally occur within a 2-tile radius around you. These EMPs can and often do hit the tile you're on, and they cause the same effects as the EMP grenades (radios malfunctioning, batteries draining, etc.) No effect.
Polycythemia Your breathing quickens. Harmful +10 If you have less than 600 units of blood in you, you regain blood at an accelerated rate (3 units per second, compared to just 1 per second), until you reach 600 units. Doesn't seem too bad, until you starting developing hypertension from your heart having to pump to all that blood... No effect.
Anemia You feel lightheaded. Harmful +10 Your body can now accommodate only 400 units of blood, and if it goes over that, it quickly loses it. As a result, you'll often be at risk of entering shock, and bleeding out is more dangerous. No effect.
Vestigial Ballistics You feel intense pressure in your hip and shoulder joints. Harmful +15 Lets you launch a random arm or leg of yours at someone, dealing a fair chunk of brute damage. If not synchronized, your limbs will also occasionally pop off on their own, and intentionally ejecting them hurts you a bit. Explosions also have a higher chance to delimb you. The Discount Superhero Spooktober job randomly gets a "weaponized" variant that also makes the limbs knock the target down and stun them for a fair amount of time; if this happens, they also get regeneration to complement it. Your ejected limbs deal double the damage.
Chronal Additive Inversement You feel as if you're impossibly young. Harmless 0 Flips the sign of your age, essentially making it negative if it was positive or positive if it was somehow negative, e.g. 30 becomes -30. (In fact, "additive inversement" is just a fancy way of saying sign change). If removed, flips it again, hopefully setting you back to normal. This causes some...interesting effects on the pitch of your voice clips. No effect.
Temporal Displacement You feel as if you're impossibly young. Harmless 0 Every few seconds, sets your age to random number between -80 and 80, indirectly shifting the pitch of your voice clips. No effect.
Chronic Sneezing You feel an irritating itch in your nose. Harmful 0 You sometimes sneeze, causing you to drop whatever you where holding. No effect.
Protanopia Everything starts looking a lot more yellow. Harmful 0 You can't see the color red and, to some extent, green. Instead you see yellow. Werewolves have this when transformed. No effect.
Deuteranopia Everything starts looking a lot less green. Harmful 0 You can't tell the difference between red and green, and everything else looks a lot more amber. No effect.
Tritanopia Everything starts looking a lot less blue. Harmful 0 You can't tell the difference between blue and green, and everything else looks a bit more desaturated. No effect.
Trichochromatic Shift Your hair itches. Beneficial 0 Gives a Trichochromatic Shift ability that switches your hair colors around; this works even if you only have one piece of hair, because it looks at all three colors you set in your Character Preferences. Due to how it shifts colors around, three uses of the ability sets your hair colors back to normal.
More specifically, the color you set for Bottom Detail becomes color for Top Detail, Middle Detail Bottom Detail, and Top Detail Middle Detail. For example, if you had grey Einstein hair for Bottom Detail, white Twirly mustache for Middle Detail, and black Eyebrows for Top Detail, you'd then have white Einstein hair, a black Twirly mustache, and grey Eyebrows.
Dwarfism Did everything just get bigger? Harmless 0 You are shorter. More specifically, the games cuts off a couple of rows of pixels in your sprite's leg area, so you should mostly look alright. This can combine with Body Type Mutations, so you have dwarf monkeys, dwarf lizards, etc. You also get an extra 10% heat and cold resistance. Miners have a 20% chance of spawning with this mutation, because according to Tolkien, dwarves love to mine. No effect.
Body Type Mutations
Body Type Mutations cosmetic Mutations that change your Body, Appearance or even Race. You can only have one active at a time. You can activate these through the Body menu or just like any other Mutation.
Even if you are not a Human, you are still protected by the Rules.
Mutation Message Effect
Bioluminecent Overdrive Your skin begins flashing! Your skin begins to rapidly flash different colors, similar to GBS' symptom but without any of the deadliness.
Melanin Stimulator N/A Turns your skin and hair EXTREMELY dark.
Melanin Suppressor N/A Turns your hair and skin to an extremely light shade and makes your eyes red. Essentially albinism.
Melanin Eraser You feel oddly plain. Turns your hair and skin EXTREMELY light. Essentially vampire/pale look. Mime always spawns with a version of this mutation that cannot be removed.
Saurian Genetics Your skin feels oddly dry. You turn part lizard/reptile. You have special eyes, literally! They can read messages written by infrared pens, their vision in the dark goes 1 tile farther than humans, and they can see through the invisibility cloaks created by chameleon, cloak of darkness, Grinches' Cloak ability, and Vampires' Bat Form MkII ability (but not cloaking devices).
You have a tail like a T-rex too, and if it dies or goes missing, you become clumsy until you get a new tail. Luckily, you can regrow your tail via, naturally, the Regrow Tail ability, if you've eaten enough of certain organs to afford it. If you already had a tail, Regrow Tail makes you snap if off and regrow a new one. The ability has a five minute cooldown, i.e. once you use it, you need to wait 5 mins to do it again.
In addition, your thermoregulation is significantly slower, at 20% the rate of normal humans (0.025 Kelvin for humans vs 0.005 for lizards). This doesn't mean fire or whatever heats/cools you less; rather it means that your body readjusts its internal temperature in response to those stimuli at a slower pace. You might shiver at room temperature, but wearing a winter jacket (or anything with 45% Cold Resistance) will stop that.
The colors for scales, tail, a belly spot, and/or head crest are inherited from your hair colors, and are typically somewhat less saturated. Top detail color influences scales and tail color, the middle detail the belly spot and tail underside, and the top detail the crest. These colors can be changed through genetics, and the belly/head spots can be changed via hair dye. You also extend every 's' into a hiss, like a snake. You are also able to change your colors through two abilities fueled by eating the organs of humans and monkeys.
Note: Don't steal peoples' organs unless you're an antagonist, they're okay with it, or they're dead. Crimes in the name of fashion are still crimes!
Ossification You feel kinda thin. All your meat and organs squish into your bones, turning you into a very spooky living skeleton who can make certain hotdogs hop. Drinking milk also heals a little bit of BRUTE and BURN. Your eyes look like tiny skulls, which is very strange. You also bleed calcium. Yes, you can drink calcium to restore lost "blood", but stuff like filgrastim and similar chems still work as normal. Don't think about it too much, and try not to get addicted to the satisfaction that comes with making spaghetti.
Aquatic Genetics You feel wet and squishy. You turn part squidperson/ithillid/starspawn. Your skin turns purple-pink, your eyes turn yellow, and you grow mini-tenacles and fins on your head that allow you move through liquids without slowing down. And, yes, you can breathe underwater.
Blattodean Genetics You feel like crawling into somewhere nice and dark. You turn part cockroach, though some say it's more like those ants from A Bug's Life but not as blue. You become immune to most forms of radiation and can see a tile further in the dark than usual, but sources of blunt and crushing damage (e.g. a fire extinguisher or a door closing on you but not a welder or kitchen knife) do 1.5 times more damage, making you considerably more vulnerable to blunt-force trauma.
The color of your exoskeleton is based roughly on the skin tone you chose for your profile in your character setup, with a fair amount of saturation. Similarly, the color of your scelera matches what you set for eye color on your profile.
Speaking of color, your blood is a bright blue-green, because it's actually hemolymph. Blood-related chems like filmgrastim work as normal, and Vampires and other bloodsuckers can still gain nourishment from you.
Primal Genetics You go bananas! You become a Monkey. See that page for more details.
Bovine Genetics You feel like you're ready for some Cow RP. You become a cowperson. Specifically, you look like a Holstein Friesian cow, complete with horns and hooves that change color depending on the color you set for Bottom Detail and Mid Detail in character preferences, respectively. You also have special cow eyes with horizontal pupils, which you can set the color of in the character setup menu. You have funny *screams, extend your m's a lot, and say "human" instead of "cow", because deep down, you truly think you are one.
As a cow, your blood is milk; all the other blood-related chemicals still function as normal, and drinking milk does restore blood. Speaking of blood, you start with hemophilia, so you tend to bleed more often when it's possible. You can also *milk (no hotkey, so you must do say "*milk or similar, like other emotes) to produce milk into a container you're holding or onto the floor, if you aren't holding one. Yes, this means you're actually pouring out your blood, so milking too much can kill you, and the game won't try to stop you until you have absolutely no blood/milk left.
Because of your sturdy hooves, you cannot be tripped by glass shards, even plasmaglass ones. Said hooves also make you do an extra 4 damage when kicking. However, they can't fit shoes, so be extra careful when playing Janitor or Clown. You can set the color of the bottom of your hooves using the second hair color option in the character setup menu. You also have a tail, and if you lose that, you lose your balance too until it's restored.
Canine Genetics You feel like barking up the wrong tree. You become a pugperson, a challenging mutantrace based around your favorite adorable pets. You take double oxy damage and are deathly allergic to chocolate (carry spaceacillin if you don't wanna die!), but you carry some benefits as well! You can sprint right up until you're out of stamina, where you'll fall on your face dramatically and hilariously. You also jump at things people throw around you, giving you the fastest (albeit possibly most misdirected) reflexes out there.
The real benefits come from pugs' natural detective abilities. You are able to sniff out a very large amount of information from people, using the *sleuth emote.
1. Using *sleuth on a mob will tell the pug what color the mob smells like.
2. Using *sleuth on an object will tell the pug the color of one of the people that interacted with it and a general idea of how long ago.
3. Using *sleuth over and over on the same object will uncover all the colors of the people that interacted with it
However, you cannot use this ability if you are poisoned by chocolate! Dying pugs can't be playing detective, but if they are in need of assistance, they can eat the bone that they start with, which is filled with buffs.
Booster Gene
Booster Genes are a group of mysterious Mutations that, on their own, do absolutely nothing. However, they interact with other Mutations in various and interesting ways.
Mutation Effect
Booster Gene X Activates every Potential Mutation in the organism.
Booster Gene Y Randomizes the organism's Potential Mutation and removes all active Mutations.
Booster Gene Z Removes all Potential and active Mutations in the organism.
Booster Gene Q Has random, unpredictable effects on the organism.
High Complexity DNA
This is a rare mutation which cannot be researched or activated using a DNA Activator, it can also only be Sequenced which means the occupant must be in the GeneTek scanner. When activated and stored in Mutation Storage, it serves as a wildcard for combining Stored Mutations, so you can very easily get some fascinating and rare Mutations this way. When activated it unlocks powerful Research.
Chromosomes
Chromosomes are Mutation modifiers. They can be be spliced with Mutations. Each mutation can only be spliced once. Each time you activate a Mutation you gain 2-5 random Chromosomes. Each GeneTek console has its own Chromosome storage.
To splice a Chromosome with a Mutation click Stored Chromosomes, pick a Chromosome, click Mark for Splicing. Find a Mutation which you want to splice and press Splice Chromosome.
There are different types of Chromosomes:
Stabilizer - Removes the Stability penalty from the Mutation.
Synchronizer - Makes the Mutation less dangerous to the organism. This has multiple different effects depending on the Mutation it's spliced with.
Weakener - Makes the Mutation Reclaimable and doubles the amount of Research Materials you gain from Reclaiming.
Reinforcer - Makes the Mutation mutadone-proof, meaning that the only way it can be removed is through the GeneTek console.
Power Booster - Makes the Mutation more powerful!
Energy Booster - Halves the cooldown of a Mutation.
Camouflager - Hides the message associated with gaining a Mutation.
Research
You can buy extra features and upgrades through Available Research. Research is shared between all GeneTek consoles.
In return for slowing down the cloning process with Advanced Genetic Analysis enabled on the cloner all Research cooldowns are reduced by 5%. Up to two active cloners will reduce the cooldown.
Research Tier Requires Time Cost Effect
Radiation Emitters 1 Nothing 90 80 Re-roll the pool of all Mutations of an occupant. This will cause severe radiation poisoning that will have to be treated. This can not be used on dead organisms and has a cooldown time of three minutes. You use these via Scramble DNA when you click on the Potential.
Gene Sequence Checker 1 Nothing 90 50 Checks how many base pairs are stable. It has a cooldown of one minute. Correct DNA pairs will turn green and incorrect pairs red.
Gene Booth 1 Nothing 60 50 Lets you sell Mutations at the Gene/Genetics Booth, a machine that lets you give out Mutations without leaving Genetics (for the most part). More on that here.
Advanced Mutation Research 1 Mutations Researched: 20 90 50 Halves the base cost and time of researching a mutation and enables the ability to see, research, and activate advanced mutations. Advanced mutations are generally very powerful and/or unique.
Biotic Cooling Mechanisms 1 Fire, Cold and SMES Resistance 90 150 Halve the cooldown times for all equipment.
Complex DNA Research Efficiency 1 High Complexity DNA 120 50 Research costs and time decrease by 15%.
Complex DNA Mutation Storage 1 High Complexity DNA 120 50
Adds five saving slots for storing mutations.
Complex Material Storage 1 High Complexity DNA 120 50 Increases maximum materials storage by 50.
DNA Reclaimer 2 Gene Sequence Checker 240 100 Allows unwanted genes to be converted into research materials. It has a two minute cooldown and has a chance to fail depending on what gene is being reclaimed.
Radiation Dampeners 2 Radiation Emitters 180 80 Halves the amount of harmful radiation caused by Radiation Emitters.
DNA Injectors 2 Mutations Researched: 20 240 120 Allows the manufacture of Injector syringes that can insert Mutations into other subjects. More on those here.
Emitter Coolant System 2 Radiation Emitters 180 120 Reduces the amount of time required for Radiation Emitters to cool down.
Mutation Storage 3 DNA Reclaimer 300 100 Allows for storage of up to three genes in each GeneTek console's Stored Mutations for the purposes of combination or transference into new recipients. The Mutations must be researched and activated before storage. Combining Stored Mutations can produce rare or unique mutations! Experiment!
Precision Radiation Emitters 3 Radiation Dampeners, Emitter Coolant System 300 150 Upgrades the Radiation Emitters in the scanner so they can target single Mutations at a time. The Mutations must have been researched first, and doing this has a longer cooldown and greater irradiation amount than regular DNA scrambling.
Improved Material Storage 3 DNA Reclaimer 300 125 Increases the maximum number of research materials to 150.
Biotic Radiation Dampeners 3 Radiation Dampeners, Radiation Resistance, Radioactive 250 100 Completely removes the harmful effects of the Radiation Emitters.
Expanded Mutation Storage 4 Mutation Storage 450 120 Adds two additional saving slots for Mutations.
Combining Mutations
Once you have researched Mutation Storage, active Mutations can be stored and combined to yield new and more useful Mutations. Some of these are only available via combination, whereas others may appear (rarely) as Potential Mutations. There isn't any penalty to getting an invalid combo, so feel free to experiment and see what results you get! Mutation combinations are not considered secret content, so if you discover one, you aren't required to ask for permission, preface it as spoilers, or otherwise take extra precautions to share it.
If you want to skip the discovery part and go straight to learning the combos, you check out this unofficial guide.
Lesser-Relevant Menus
Alongside Potential, these menus appear when you have someone in the scanner. Compared to Research and Potential, there's not much to say about these. They still have a purpose, mind you, but they do far less than the other ones. and are way less important.
Mutations Menu
This shows mutations which are active. If you have the Mutation Storage or Gene Booth upgrade, this is where you go to store or sell them. While you have the same 'Potential after getting cloned, you lose any active mutations after getting cloned, so people coming out of the cloner usually have this empty, unless the cloner had Advanced Genetic Analysis enabled.
Body
This lets you change the occupant into a variety of lovely forms depending on what mutations you've researched, such as a lizardman or a giant cockroach. By default, Human and Primal Genetics (monkey) are available.
Appearance
This one opens up a menu just like the one in the Character Selection screen, where you can change the hair style (s), hair color, skin tone, eye color, and various other cosmetic things about the occupant. If you want to give people obnoxious Sailor Moon hair or colorful Rainbow Afros, this is the place (and the only place at that, as this is pretty much the only way to get those unique hair styles). Only appears if whoever's in the scanner is a race that can accept these appearance options, namely humans.
Goonstation Gene Combinations
The partner of any gene labeled with (PRIORITY) in a recipe can be replaced with high complexity DNA and still yield the same result.
Results appended with a (*) have a special note that can be read by clicking the row.
Filter
Natural Anti-ToxinsMusculature EnhancementAdrenaline Rush
Ethanol Production (PRIORITY)Natural Anti-Toxins (PRIORITY)Alcohol Resistance
Adrenaline Rush (PRIORITY)Aquatic Genetics (PRIORITY)Anaerobic Metabolism (*)
Blattodean Genetics (PRIORITY)Natural Anti-ToxinsApidae Metabolism
Irritable BowelsPseudonecrosis (PRIORITY)Apocrine Enhancement
Dactyl CrystallizationApocrine EnhancementAquatic Genetics
Musculature EnhancementSelf Biomass ManipulationAquatic Genetics
GlowyRadioactiveBioluminescent Overdrive
GlowyChameleonBioluminescent Overdrive
Apidae MetabolismApocrine EnhancementBlattodean Genetics
Apidae MetabolismRadioactiveBlattodean Genetics
Incendiary MitochondriaDermal GlowBlazing Aura
Fire Breath (PRIORITY)Dermal GlowBlazing Aura
Diminished Optic NervesNarcolepsy (PRIORITY)Blindness
Apocrine EnhancementIrritable BowelsBrown Note
High-Pressure LarynxIrritable BowelsBrown Note (*)
Unstable RefractionMelanin SuppressorChameleon (*)
Unstable RefractionMeta-Neural Haze (PRIORITY)Chameleon (*)
Unstable RefractionMelanin StimulatorCloak of Darkness (*)
Cryokinesis (PRIORITY)GlowyCold Resistance
Frontal Gyrus Alteration Type-CFrontal Gyrus Alteration Type-T (PRIORITY)Coprolalia (*)
Dactyl Crystallization (PRIORITY)Fire ResistanceCryokinesis
GlowyDermal GlowDermal Glitter
Meta-Neural AntennaSpatial DestabilizationDimension Shift
Musculature EnhancementEthanol ProductionDwarfism
Musculature EnhancementAlcohol Resistance (PRIORITY)Dwarfism
Musculature EnhancementApocrine EnhancementDwarfism
Cloak of Darkness (PRIORITY)Meta-Neural EnhancementErebokinesis
Chameleon (PRIORITY)Meta-Neural EnhancementErebokinesis
Unstable Refraction (PRIORITY)Meta-Neural EnhancementErebokinesis (*)
Natural Anti-ToxinsApocrine EnhancementEthanol Production
Chronic Cough (PRIORITY)Incendiary MitochondriaFire Breath
Incendiary Mitochondria (PRIORITY)Glowy (PRIORITY)Fire Resistance
Frontal Gyrus Alteration Type-BFrontal Gyrus Alteration Type-C (PRIORITY)Frontal Gyrus Alteration Type-O
High-Pressure LarynxConstricted Larynx (PRIORITY)Frontal Gyrus Alteration Type-X
Frontal Gyrus Alteration Type-B (PRIORITY)Frontal Gyrus Alteration Type-E (PRIORITY)Frontal Gyrus Alteration Type-X
Constricted LarynxParanoia (PRIORITY)Frontal Gyrus Suspension
Musculature Enhancement (PRIORITY)Radioactive (PRIORITY)Gamma Ray Exposure
Dermal Glitter (PRIORITY)Melanin Suppressor (PRIORITY)Glowy
Dermal GlitterMelanin Stimulator (PRIORITY)Glowy
Dermal GlitterDermal GlowGlowy
Midas Touch (PRIORITY)Natural Anti-ToxinsHealing Touch
Midas TouchSelf Biomass Manipulation (PRIORITY)Healing Touch
Anemia (PRIORITY)Polycythemia (PRIORITY)Hemopoiesis Overdrive
Irritable Bowels (PRIORITY)Apocrine Enhancement (PRIORITY)High Decay Digestion
High-Pressure LarynxIrritable BowelsHigh-Pressure Intestines
Aquatic GeneticsMelanin StimulatorInk Glands
Aquatic GeneticsDermal GlitterInk Glands
Aquatic GeneticsChronic SneezingInk Glands
Musculature EnhancementPrimal Genetics (PRIORITY)Jumpy
Chronic CoughEthanol ProductionMass Emesis
Chronic CoughApocrine EnhancementMass Emesis
Chronic Sneezing (PRIORITY)Ethanol ProductionMass Emesis
Chronic SneezingApocrine EnhancementMass Emesis
Meta-Neural Enhancement (PRIORITY)High-Pressure Larynx (PRIORITY)Meta-Neural Antenna
Dactyl CrystallizationEthanol ProductionMidas Touch
Dactyl CrystallizationDermal GlitterMidas Touch
Physically Unfit (PRIORITY)Natural Anti-ToxinsMusculature Enhancement
RadioactiveSpatial Destabilization (PRIORITY)Mutagenic Field
Apidae Metabolism (PRIORITY)Apocrine EnhancementNectar Persperation
Diminished Optic NervesGlowyOptic Energizer
Paranoia (PRIORITY)PseudonecrosisOssification
Cloak of DarknessPseudonecrosisOssification
X-Ray Vision (PRIORITY)PseudonecrosisOssification
GlowyMeta-Neural EnhancementPhotokinesis
Dermal GlitterMeta-Neural EnhancementPhotokinesis
Dermal GlowMeta-Neural EnhancementPhotokinesis
Front Gyrus Suspension (PRIORITY)BlindnessPrimal Genetics
Front Gyrus SuspensionDeafness (PRIORITY)Primal Genetics
DeafnessBlindnessPrimal Genetics
RadioactiveGlowyRadiation Resistance
Dermal Glow (PRIORITY)Apocrine EnhancementRadioactive
Adrenaline RushHealing Touch (PRIORITY)Regeneration
Cranial Keratin Formation (PRIORITY)ChameleonSaurian Genetics
Cranial Keratin FormationFire ResistanceSaurian Genetics
Telepathy (PRIORITY)Meta-Neural Antenna (PRIORITY)Telekinetic Pull
Meta-Neural EnhancementConstricted LarynxTelepathy
Fire Resistance (PRIORITY)Cold Resistance (PRIORITY)Thermal Resistance
Dyspraxia (PRIORITY)Coprolalia (PRIORITY)Tourettes
Mass EmesisIrritable BowelsVestigal Ballistics
Optic Energizer (PRIORITY)Blindness (PRIORITY)X-Ray Vision
--------
The Department
Genetics.png
Welcome to Genetics. Just across the morgue lies a mystical realm where some of Nanotrasen's greatest minds entertain themselves by toying the Human Genome into knots.
The first thing you're going to see is that our department has two rooms. The first, the one you walk into as you enter from medbay, is the Cloning room. It has only one Cloning Console, one DNA Scanner, and one Cloning Pod. More on this later.
The second room is the one where you're going to spend the most of your time. This is where things get done, where people go to become hulking supermutants, where you are going to do. Your. Job. This room has two DNA Scanners and two DNA Scanner Access Consoles, along with two diskette boxes and a few lockers. The medicine locker has a syringe box and anti-toxin bottles. This is quite useful, as any tampering with genetic code gives Toxin damage. The bio-hazard locker has pretty much what you expect it to have - a bio suit and bio hood. Useful if a disease breaks out. The diskettes are also extremely useful, as we will see later.
The third room has your test subjects! These monkeys are going to be your guinea pigs, you are going to experiment on them, and make the suffer quite a bit. It's pretty inhumane. But such is life, and after a few seconds, it will all be worth it. They actually have it pretty easy, it's better than getting gibbed and eaten.
This is going to be your home, buddy. Get used to it. It grows on ya!
Scanner.gifMedcom.gifClone.gif Cloning
When you first hear about "cloning", you may think that people are referring to making many clones of yourself so you can take over the station. This is not the case (although that can be done too, just not exactly that way). Cloning is a process of of reviving someone who has died. For a cloning process we need a dead body and cloning equipment, which can be found in your Cloning Room.
First of all, you have to know that for all things cloning, the Chief Medical Officer has a final say. He is your boss on this side of Genetics. If he tells you to clone someone and not some other guy, you do it. The only person with higher say than him on these matters is the Captain.
On to the specifics! How does cloning work, you ask? Well, it's quite simple! Just grab or pull a body and stuff that puppy up in the DNA Scanner and close the door. If you want to remove someone from a Scanner, click on it to open the door. Unless the Scanner is locked, the person/monkey inside is going to pop right out.
After the Scanner is already occupied, interact with the Cloning Console. You will see a few things. Now, the most important is the first. Click Scan to see if the person inside is actually not an empty husk! If there is no ghost inside the corpse, you will get a "Mental interface failure!"-message, and you will not be able to clone that person. If that happens, try waiting a minute and try again (the ghost gets a message in their chatlog when their body is put into a Cloning Pod and it might take a few seconds to notice it). If they still do not respond, however, take the corpse to the morgue and be done with it. Corpses who seem to have suicided with no hope of recovery cannot be cloned and you should be taken straigh to the morgue.
If there IS a ghost in that corpse, however, you will get a Successful Scan -message. That means you now have that person's cloning data saved. You can use that at any time. But, after it's used, it's erased from the records. The only way you can save a person's genetic data is with a Cloning Diskette, which is found in the DNA Modification room.
After you actually have DNA data from a person, click Check Records, and then select the person who you want cloned. You will see a list of their UI+UE (Unique Identifiers + Unique Enzymes) and their SEs (Structural Enzymes), which are quite irrelevant. Click Clone. You will notice that the Cloning Pod is now fully active, with a shadow inside. That is the new body. You can now take the old corpse out of the DNA Scanner, strip it completely so the cloned person can have their stuff back, and place the old corpse in the morgue. You don't have to worry about it anymore.
The cloning process takes from 2 to 3 minutes. For whoever is getting cloned, it seems like a very long time. But it's not long for you. While the guy is getting his new body set up, take his belongings and stuff them all in the locker right by the cloning pod, so their stuff isn't scattered all over. Plus, cloning the captain and leaving his ID and other secure items on the floor sure is bad.
Hypercloning: Use this if you are in a hurry and you'll be 3x as efficient at cloning. During the cloning process, it is possible to eject the incomplete clone by unlocking the Cloning Pod with your ID and ejecting the unfinished clone (needs to be >40% done) or if by getting an Engineer to unlock the Genetics APC so you can shut off the power temporarily, which also causes the clone to (instantly, no matter how done) eject.
The clone will not live long and cannot function like this, so it needs to be stuffed into a Cryogenics chamber where the Cryoxodone will repair cellular damage
After the clone has been finished cryogenic treatment, give them Mannitol if some was not included in the Cryotubes chemical mixture
After the pod is empty, feel free to clone your next patient, and to let the old one out, since they most likely don't have clearance to open the door.
If R&D has been doing their job, they might upgrade the cloner to a level where it can autoprocess. If this is the case, you only have to press the Autoprocess button on top of the window, and the cloner will scan automatically (also allowing self-scans) and clone anyone in the backup storage as soon as they die.
OH GOD OH FUCK Hark! A Husk!
So you've come across a husk (a gray, dead guy) on your floor, which means you can't clone that poor sod. Before you go throwing that body in the morgue, they can still be helped!
First off, make sure it's a husk. Throw the body into a DNA Scanner, if it says Subject no longer contains the fundamental materials required to create a living clone, then you have yourself a husk (if your DNA Scanner had been updated to the max by the Scientists, you could clone the husk right now. So if you know they've been doing their R&D, ask them).
Take the body down to Surgery.
Pester the CMO or a Medical Doctor to extract the brain, or do it yourself.
Run back to Genetics and grab a humanized monkey.
Return to Surgery and remove his brain too. Do whatever you want with that one, it isn't important.
Now shove the husk's brain into the monkeyman's corpse and clone the monkeyman.
If all goes well then your cadaver will be reborn! Admittedly in a different body.
Helping the Headless
Sometimes you'll find corpses who are lacking a head. Since cloning requires a brain, you cannot directly clone them.
If you have the head, use a surgical saw or any sharp item (such as a glass shard) to extract the brain, then put it on a monkeyman's corpse, using the same procedure as above.
Alternatively, get robotics to augment the body with a cybernetic head, then insert the brain in there, and put the body in the cloner.
If you don't have the head, but have the body, not all hope is lost: take a blood sample and give it to the botanist to make a replica pod, and the deceased guy will be reborn as a podperson!
Scanner.gifMedcom.gif DNA Modification
Your boss here is no longer the Chief Medical Officer. Do not feel forced to listen to his orders, except when it comes to cloning. Regarding the research, listen to direct orders from the Research Director as well as the Captain. For security reasons allow NO ONE ELSE in the Modification room. Simple as that.
Now, let's get you acquainted with the DNA Scanner Access Consoles next to the monkeys. It has a few things of note. First of all, you're going to notice two clickable lines:
Modify Unique Enzymes (UE) / Unique Identifiers (UI)
Modify Structural Enzymes (SE)
You might ask yourself: What does this mean?
Unique Enzymes = just what identify who you are, your name. Even if you change them, it will have no effect. What does change stuff is you transfering them from one person to another, effectively changing their name.
Unique Identifiers = merely your cosmetic details - eye color, skin color, hair style, hair color and gender. You don't really have to mess with any of these, and they are quite unimportant.
Structural Enzymes = extremely important! They contain data relevant to your genetic structure. This governs your race, and messing with it carelessly might give you disabilities. For those that handle genes with care, however, great benefits are to be had.
[3F3] [5B1] [4A7] [391] [7FF] [102] [07E]
[7B9] [130] [230] [4E0] [552] [7A4] [715]
Structural Enzymes or SEs like this. Well, not exactly this, this is just an example. Everyone's SEs are individual. They might also just be a one long line instead of two, depends if you stretch your DNA Access Console screen window. The SEs consist of 57 characters which are divided into 19 sub-blocks, with 3 pieces each. Let's see what purpose these blocks and characters have.
Structural Enzymes - Powers, Disabilities & Species
There are 19 blocks which control disabilities or powers and one block which controls whether the subject is a human or a monkey. The string is in Hexadecimal - which means base 16 in math terms. It means a number can range from 0 - as normally, zero - to F - equivalent of 16 15. So, it can go like this, from lower to higher:
0 1 2 3 4 5 6 7 8 9 A B C D E F
That means that a result of F is higher than a result E. This is important, so remember this. "Keep this block below 8xx", means you have to keep the first sub-block in a block below 8, and the subsequent sub-blocks don't matter. "Keep that block above DAC", means that that block must have it's first sub-block equal to or higher than D, if it is equal, the second sub-block must be equal to or higher than A... and so forth.
The first number in each block is the most important one. It controls whether a disability is active or inactive, whether a power has a chance to activate or not, and the race of the subject.
Hulk.png Mutations and Their Consequences
Before we start splicing, you must know what possible monstrosities can be done to a human.
Mutation Name Description Indicators Message
Telekinesis This power allows the subject to control things with their mind, from far away! It is the most sought after power, since it allows for incredible deeds, and makes a strong robuster nearly immortal. Appears as a blue glow around the subject's head. "You feel smarter"
Hulk This is pretty obvious. Subject becomes extremely strong, enough to punch through reinforced walls, and is unable to speak without yelling. The subject is also immune to stuns and cannot be pushed past. Subject turns green and has red eyes. "Your muscles hurt."
Cold Resistance This makes the subject resistant to cold and lack of pressure, effectively allowing it to survive in space (they still have to wear internals, however). This will not make them immune to fire. Subject has a pulsating orange-blueish "aura". "Your body feels warm."
X-Ray Vision Also a very good power. Basically, it gives the subject the ability to see everything that is beyond their normal vision: walls, furniture, even other people! This, combined with Telekinesis, is a deadly combination. Subject's eyes "glow eerily" if looked at with a penlight. "The walls suddenly disappear."
Chameleon The subject becomes able to subtly alter light patterns to become invisible, as long as they remain still. Subject starts fading into the background. "You feel one with your surroundings."
Dwarfism Turns the subject into a manlet, making them unusually shorter than the rest of the crew. Dwarfs can pass over tables without stopping. Subject looks smaller. "Everything around you seems to grow.."
Nearsightedness Makes the subject's screen go hazy at about halfway from the edge of your whole vision. It's not THAT bad, and can be temporarily fixed by using prescription glasses. \ "Your eyes feel strange."
Epilepsy Subject starts to fall down and keeps shaking all the time. They're horrible, and there's no easy cure short of fixing the block. Subject falls down. "You get a headache."
Coughing Makes the subject drop small items you're holding, like syringes. Pretty harmless, but has potential to be extremely annyoing. Subject coughs. "You start coughing."
Tourette's Syndrome The subject swears all the time. They may also experience paralysis that takes even longer than the seizures. Avoid. Subject curses out loudly and twitches. "You twitch."
Nervousness Makes the subject stammer. Annoying at best. Subject stammers when they speak. "You feel nervous."
Blindness Subject goes completely blind and are now a part of a usually forgotten minority, so sad. Subject's eyes don't react to penlight. "You can't seem to see anything."
Deafness Makes the subject deaf. Harmless at best, annoying at worst. You just don't hear anything, not even yourself. \ "You can't seem to hear anything..."
Clumsiness Subject has a clown-like clumsiness. For those that have always wanted to be clowns. It makes the subject accidentally drop things they hold, unable to use tasers, handcuffs, guns exploding in their face etc. \ "You feel lightheaded."
Strangeness Makes the subject randomly mutate. Very dangerous. Definitely be careful with this one. Subject mutates on their own. "You feel strange."
Unintelligible Heavily corrupts the part of the brain responsible for forming spoken sentences. \ "You can't seem to form any coherent thoughts!"
Mute Completely shuts down the speech center of the subject's brain. \ "You feel unable to express yourself at all."
Wacky Forces the subject to talk in an odd manner. \ "You feel an off sensation in your voicebox."
Cloak of Darkness Enables the subject to bend low levels of light around themselves, creating a cloaking effect. No Longer in Genetics, but can be acquired via admin spawned injector Subject is able to become invisible in low light situations. "You begin to fade into the shadows."
Smile Causes the speech center of the subject's brain to produce large amounts of seratonin and a chemical resembling ecstacy when engaged. No Longer in Genetics, but can be acquired via admin spawned injector \ "You feel so happy. Nothing can be wrong with anything. :)"
Chav Forces the language center of the subject's brain to construct sentences in a more rudimentary manner. No Longer in Genetics, but can be acquired via admin spawned injector \ "Ye feel like a reet prat like, innit?"
Swedish Forces the language center of the subject's brain to construct sentences in a vaguely norse manner. No Longer in Genetics, but can be acquired via admin spawned injector \ "You feel Swedish, however that works."
Elvis Forces the language center and primary motor cortex of the subject's brain to talk and act like the King of Rock and Roll. No Longer in Genetics, but can be acquired via admin spawned injector \ "You feel pretty good, honeydoll."
IMPORTANT: There's also 1 special block which contains the info whether the subject is a human or a monkey!
DNA Injector.png Buffers and Injectors - Saving Your Work and Handing Out Godhood
This is how you save your work. A very good Geneticist once said: Save early, save often. His words are true. You have to save your every step in order to acquire a perfect serum. That means you have to be patient enough to bending the block to your will, dedicated enough to remove every disability, and responsable enough to save everything to make sure nothing goes wrong.
In the main DNA Scanner Access Console screen, click Buffer Menu. This is your buffer screen. You will notice there are THREE buffers there. More than enough. Each buffer can save either an UI, or an UI+UE, or, more importantly, an SE. Generally speaking, you will only ever bother with the SE part.
To save your work into a buffer, once your pod is occupied, simply click Save to Buffer. This will save the subjects Unique Enzymes, Unique Identifiers, and Structural Enzymes. You can make individual injectors of each of these, but not one with all. What you saved is now backed up by the console, and, if not overwritten, is now safe. Good stuff. You can relabel the buffer to make sure of what it is. For instance, calling your original test subject's SE something like "Clean Backup - Stevenson, F.", or calling an SE that has Hulk isolated something like "Hulk". Simple, but very helpful to not get lost.
You can transfer a buffer's content into the pod's occupant, making it easier to transfer research data between subjects. Just stick a test subject in there, click Buffers, as usual, then click Occupant, right after Transfer To:.
By using the Occupant - Delayed button, the scanner will apply the buffer's content onto the next person who enters the scanner. This is mainly useful for self-experimenting, but be sure of having a clean backup when doing so.
Make use of all three buffers. Assuming you have a human with clean SEs inside your pod, you can save his SE in the first buffer, and name it "Clean Backup". The last two buffers can be used to find powers. Say, once you find your first power, you save it to the second buffer. Once you get your second power working with the first, save it to the third buffer. Once you get the third power working with the others, overwrite the second buffer, since it is now irrelevant. Same thing with fourth power.
Diskettes can use them to backup your work as well! With one in your hand, click the DNA Scanner Access Console. Now enter the Buffer screen. Click Save To in there to save the data to the diskette. If the diskette is not write-protected, the data is going in there! From the main screen, you can eject the disk from the console. You can also load data from a diskette much the same way. Except you click in Load From in the buffer screen, instead of Save To.
That covers buffers. But "what are DNA Injector.png DNA Injectors?" you may ask yourself. Well, injectors are tiny one-shot needles, that contain buffer data, whatever it may be. That means you can now turn that sweet, sweet Hulk buffer into a small, awesome, orange/red injector! Good stuff. To turn a buffer into an injector, simply click Injector in the options below the buffer in question, after "Transfer To:". A small needle will spawn on top of the DNA Scanner Access Console. You can now stick his baby in anyone who stands around for enough time. It's important to note that unlike using the scanner, injectors have a 100% chance to actuvate power blocks, but have a limited duration; this is true of both SE and UI/UE injectors.
The DNA Scanner Access Console takes time to make another injector. Something like 90 seconds or close to it.
Because of injectors, Geneticists are usually asked to give people superpowers. This is best judged by the Research Director, who is in charge of the research. If you want to be like Marvel and give everyone superpowers, be ready for Security Officers knocking on your door because nothing gets the station down like a herd of assistants with Hulk. So be ready to say "no" a lot. Usually the Geneticists are allowed to have powers, but note that if you run around the station while being a hulk, you're probably going to get a lot of attention from the security and be the prime suspect if (when) anything happens. Don't go on a killing/destroying rampage if you're a hulk, it is a bannable offense.
Note: Admins have confirmed that if people inject themselves with a needle they found lying around that says "Godhood" on it without even asking what is in it, you will NOT get punished by turning them into monkeys. Wink wink. Just make sure to answer truthfully if asked, and not to inject it yourself. If people are stupid enough to inject themselves with unknown content, let them.
Manhandling Genes!
This guide here shows you step by step how to find the powers from the mysterious blocks!
Genes are distorted and twisted by shooting them with radiation. This can be done with the DNA Scanner Access Console and the computer in your lab.
First Steps
This guide will start with using a monkey, because they're in the pen for a reason. Keep in mind, though, that this is not the only way. You could use a real life human being for this instead of a monkey, (but be sure that they're willing to give their body to science) but usually monkey's are used to we're using a monkey in this guide.
Start by taking a monkey from the pen. Knock them out if they're not willing to cooperate.
Shove them into a DNA Scanner next to the pen.
Check the computer next to it, you'll see a bunch of information. Find Structural Enzymes and try to not confuse them with the other enzyme blocks above.
At the start of the shift no one has any idea which structural block is which. They're all randomized. This is why we must do science, experimentation:
Humanizing a Monkey + Making a 'Clean SE'
Changing the monkey into a human should be the first thing you do, because it is by far the easiest block to spot! It's the only one with the value higher than 800.
Write yourself a note containing a list of 14 blocks. You already know the species block, write it down so you remember it.
Decide whether you're going to go from lower blocks to higher blocks or vice versa. If you're working with a fellow Geneticist, decide together and start working at opposite ends to maximize efficiency. Don't to focus too hard on following an extremely orderly pattern, if another untested block raises to a high level, test it out. Remember to share data with your fellow Geneticist! When working with a partner, communication is key to efficient work.
Change your radiation emitter settings to a little more potent so changes will actually happen. Changing the Output Level up to 8 and Pulse Duration to 6 works fine.
Click on the species-block's first (leftmost) character to administer radiation to it and hope it changes for the better! Repeat this step until the first value on the block is lower than 8. Keep the block below 800 for human, and above 800 for monkey.
When you got it, open the DNA Scanner to check if your monkey has turned into a human, if it has, congratulations, you've got your very own monkey-person! If no, check your list which block was the species-block and make sure it's under 8xx and try again.
Put your test subject back into the DNA Scanner. Time to clean their gene pool.
Check that all of the blocks are less than 800. By making this they should have no disabilities nor superpowers, making them perfectly normal. This is called a clean gene-pool or more commonly a "Clean SE". Note: Another way of obtaining a Clean SE is by getting a human volunteer to give theirs.
After they're clean, let's make an injector of these SE-settings. On the computer, go to the Buffer Menu tab, press the Save to Buffer button, then press the Injector button next to the SE value. It's also recommended to rename the label by clicking Rename. This injector now serves you as a "savepoint" which you can come back after an experimentation, making the research faster.
Time to go back to the drawing board for a second!
How Mutations Work
Disabilities manifest if the block is over 800.
Power manifesting is a little more complicated. It has an extra randomness added to the random! First off, to be eligible for activation their block must be over C00. After that, every time the subject's dna is updated (either by re-applying the buffer or by pulsing radiation) the power has a chance to manifest. After it has manifested, it won't disappear unless the block goes below C00.
Telekinesis: 20% chance to activate.
Hulk: 15% chance to activate.
Cold Resistance: 25% chance to activate.
X-Ray Vision: 25% chance to activate.
Chameleon: 20% chance to activate.
Dwarfism: 15% chance to activate. For some reason this is a power on the same level as hulk.
Remember that this applies only to mutating via scanner: injectors always manifest powers, if their block is above C00, but are temporary.
Manifesting Mutations
Back to business! Now we'll try to make a mutation show itself to us:
Raise a new block to over 800, preferably over C00 and hope something manifests.
Make sure it is the ONLY block with over 800, otherwise you might get it mixed up with some other block's symptoms.
Try to figure out the block's function:
First switch your target from torso to eyes and turn on the penlight stored in your suit storage. The penlight is going to be very useful for your work to find blindness / X-Ray.
To test someone's eyes, use the penlight on the subject's eyes. If you get a "[subject]'s pupils narrow!", this means their vision is perfect. An "eerie glow" means X-Ray Vision, and "has no reaction" means the subject is blind! Fix that ASAP!
If their vision is perfect, here's a few strategies to figure out what the block does:
Look at them if you can see anything glowing around their body or head (can be easily spotted without closer examination).
You can wait for them to curse or have a seizure.
NOTE: If nothing seems happens at all (even when self-testing), the block might very likely be a power. POWERS DO NOT AUTOMATICALLY TURN ON IF OVER THE NEEDED VALUE. THEY HAVE A CERTAIN PERCENTAGE OF MANIFESTATION EVEN IF THE CONDITIONS ARE PERFECT. So if you have a block which does absolutely nothing, keep on trying!
Ask if a volunteering Assistant can donate their body to science and give verbal feedback on what they feel when you tamper with their blocks or inject them with the SE.
Or simply self-test like a boss! Note: These options are not the only ones, there are more strategies you can find out.
Write down what you find and move on to the next block!
Self Testing
NT recently upgraded the DNA Scanners with a function that allows you to apply a buffer with a delay, effectively allowing you to modify your DNA without someone else manning the console. Using this method is a lot faster, although it will cause some radiation sickness.
To start with, keep a Clean SE on a buffer: if you get yourself a disability you want to be able to clear it!
Raise a block over 800 on your monkeyman, then save it on a different buffer.
Get the monkeyman out, press on the Occupant - Delayed button, and get in the scanner. It will automatically apply the buffer to you.
If you get a message, check the mutation list to see the effect; if it's a disability you should apply the clean buffer to yourself using the same method.
If you get no message (be sure that the block is over 800) then the block is a power! Raise the block to over C00, and it will be an active power block.
Applying an active power block to yourself won't necessarily give you the power; to know which power you're dealing with, you might want to create an injector: it will manifest the power, although temporarily.
If you got a power, save it on your unused buffer: after that, use that buffer instead of the clean one while testing, so you won't have to reactivate your powers again each time.
If you reach 100% radiation, you'll collapse: this will knock you out for a few seconds, but it's not as dangerous as it seems. Do remember to take some antitoxin once in a while though.
When you're satisfied with the powers you have, you can use the scanner to apply them permanently to yourself.
Against the Radiation
All that radiation pulsing is not healthy.
At some point it may be a good idea to visit Chemistry and order some Potassium Iodide for your genetic testing. It's a very useful chem, as it lowers low radiation levels quickly.
Anti-Toxin or Charcoal can cure the toxin damage caused by radiation, but does little to the rads themselves.
Rejuvinative Chemicals can be injected through the DNA Scanner Access Console. They slowly lower radiation (also seem to make the patient's genome more resistant to change).
If your hair falls out, use a mirror to restore it. You can find one in medbay or in the toilets.
What to do with your powers
Save your power buffer in a disk, as a backup; make another one and give it to R&D to fuel their research, and you might get night vision goggles in return, which will allow your x-ray vision to see in the dark!
Make injectors to give to the greytideheads of staff or security. You can also offer permanent powers to anyone who trusts you enough to not lock them in the scanner.
Enjoy being the peak of human evolution! Use your powers for the greater good, or to make security's life hell by breaking down walls to high security areas and by being unstunnable. Remember that hulks are nonhuman to the AI though.
Congratulations. If you read everything is this guide, you should now be a full-fledged Geneticist! Welcome to the club, friend, hope you enjoy it! Pass on the knowledge to those in need.
The Gene Genie - The Traitorous Geneticist
Sorry for the bad chapter title. I wanted to use that for a very long time.
So, you learned how to do your job successfully, and how to be a credit to the station. You learned how to manipulate genes. Now you want to learn what the hell to do when the syndicate is the one writing your checks! Well, fret not! I will give you some pointers. But these are mostly tips - traitorous objectives differ wildly, and change your actions way too much for me to write a real guide on it.
Rev head
Simple. Flash colleagues. If the RD or the CMO come check on you, say you have a good set of powers, but the replicator is offline. Ask for him / her to strip and get in the Scanner. Lock him/her in, have your way with them, they can't leave nor can they talk. Let them enjoy their slow, painful death. If someone wants to clone the captain, that too is pretty simple. Just don't do it. As soon as the guy leaves, stuff the captain in a locker, take his stuff and call it a day. You could also eat until you get fat, transform people into monkeys and eat them. Fun for all.
Another fun strategy is, if you managed to kill a head of staff, to copy their identity with a DNA scanner and apply it to yourself; impersonating a head of staff during a revolution is easy since they are usually exempt from implanting.
Traitor
Depends on your objective. If it's a hard one, like stealing the AI... well, you're fucked. Keep working on those powers! As soon as you have Hulk + TK, go for it as you wish. No tips here.
If your objective is a simple one, though, like stealing the hand tele, there are more approaches to this. As the above tip, you can just break the walls with TK Hulk, but that is rather crass. There's a more roundabout, but classier way to tackle this. Take a monkey from the pen, transform it in a human. Take it's UI+UEs, make an injector, stuff it in your pocket with a label like "Clean Backup - Alexa White".
Now get your own UI+UEs and name it "Clean Backup - Original" or something. Avoid using your name. Now, go hide somewhere close to the item's location, stick yourself with the monkey injector, spawn emag, stick ID and PDA in your backpack. For added stealth, get a different outfit. Emag your way to the captain's room, get his jumpsuit, RUN RUN RUN. The AI might see you, so it would also be good if you spawned an agent card so you can't be tracked. If anyone sees you, they're not going to see your actual name, only the humanized monkey's name. Hide, stick yourself with your own stuff, change clothes, walk away smoothly.
If you have to kill someone, same stuff from rev.
Also, never forget identity theft. Since you can take someone's complete identity, including looks, you can have some fun with that.
Wizard
Well... Stealth wizard? Several things you can do, mostly involving UI+UE stuff. Not worth it, really. One thing you can do is taking identities and belongings, but you have to expose yourself to mess with the console. Your choice.
Changeling
FUCKING REJOICE, your work is cut out for you! Have fun eating the lifeless corpses you clone. Keep in mind that transformations and transformation stings copy SE as well as the UI+UE. Turn people into horribly disabled freaks, or channel a lot of hulk-TK-xray-cold resisting supermen.
----
The Department
Ready to play with the human genome? Good! Because it's about to get very interesting.
The Genetics department is in Medbay. It has a pen full of monkeys, some cloning equipment, and a couple of DNA modifiers for experiments. This is where you'll be spending most of your time.
Cloning
Cloning is one of the main aspects of your job. Bringing people back from the dead is a delicate science, so read on. The Chief Medical Officer has the final say about what happens here, rather than the Research Director.
You can clone people from scans made while they are alive and well (which is preferred), or from a corpse (which happens more often than not). Feel free to call people to get their backups made, especially for Heads of Staff.
Cloning consumes biomass, 150 points per clone. The cloning pod starts with 150 points and you can get more biomass by feeding meat to the machine (any type of meat works). You can click-drag a stack of meat into the cloner in one go to save time.. Each meat slab adds 50 points.
To ensure that your cloner never runs out of biomass, request a bottle of clonexadone from chemistry. Pour it into a beaker, attach the beaker to an IV drip, toggle the IV drip so it drains blood (Alt-click the IV) and attach the IV Drip to a monkeyman. Alternative, use a syringe to gather blood from your monkeys and put it into the bottle, creating synthetic meat. A full small bottle will give you 30 slabs of meat, which is enough for 10 clones.
If chemistry would rather mass-produce space drugs and mindbreaker, snatch some metal from EVA (or disassemble some chairs in medbay) and build a meat spike to butcher monkeys on. Another way of getting meat is by requesting a gibber from R&D and butchering some dead people that morgue is full of.
Scan
The first thing that a clone needs is a record in the cloning console. Scanning requires a dead or live human body with its brain still in place (monkeys or decapitated corpses won't work), whereas making the actual clone requires the person to be dead.
If all you've got is a severed head or a husk with no DNA data (or just a brain), simply take a dead human, perform brain transplantation on him and proceed. It's impossible to clone people without their brain.
Grab.png Grab the person.
Click on the Scanner.gif DNA scanner to place them inside.
Click on the Cloning console.gif cloning console to bring up its menu.
Click Scan.
Click View Records to make sure their record is listed in the cloning database.
Making the Clone
Remember, a clone can only be made when the person you're making a clone for is dead and logged in. If they aren't dead or have logged out, you'll see an "Unable to initiate cloning cycle" error in the Cloning System Control.
Head to the Cloning console.gif cloning console beside the Clone.gif cloning pod, and click on it to open its menu.
Click View Records, select the person you wish to clone, then click Clone.
Make sure the cloning pod has enough biomass to produce a clone. Each clone consumes 150 biomass points.
Note: After clicking "Clone" the dead person will get a pop-up window asking if they want to come back to life. If they choose "No", the console will say "Unable to initiate cloning cycle". If they choose "Yes", the console will say "Cloning cycle activated", and their body will be remade in a few minutes. You do not need to ask in OOC. Doing this is now considered IC in OOC.
Note #2: When a new clone is made, that person's record is deleted from the database, so they must be scanned again if they are to be cloned a second time. You can use diskettes to save a record of their backup.
The cloning process can take up to a few minutes, so make sure to frequently check the cloning progress by examining the cloning pod Fuck that noise, this is the WILD RIDE and we don't have time to take a few minutes per clone. Take out your ID and tap the cloning pod with it, then right-click the pod and press 'EJECT' to eject the clone immediately. Don't worry, the cryo mix will fix up everything for you and make the process much faster. Coders hate fun, stopping a cloning midway now can lead to missing limbs.
Note: If you don't have genetics access on your ID, kick the cloning pod on harm intent until the body ejects from it.
You can check how many times someone has been cloned by using a penlight on their eyes. A clone gets a dot in their sclera for each cloning cycle they go through. Someone who got cloned 4 times would have 4 dots in their sclera.
Finishing a New Clone
Grab the new clone and take it to Cryo, the room with large Cryo.gif cryo cells.
If it hasn't been already done, insert a cryo mix (a Beaker.png beaker containing Cryoxadone/Clonexadone/both) into one of the pods.
At the start of the round, there are already two beakers containing 30 units of Cryoxadone each near both pods.
Cryo is multipurpose: a Chemist (or you, dear Geneticist, since you have Chemistry access) can add more chemicals to a mix, and potentially make a cure-all cocktail. Or if you're short on time before the Ride begins, a Cryox-Clonex-Alkysine-Ryetalin mix works just fine for speedcloning.
Click-and-drag (or grab-and-click) the clone on to one of the pods to place the clone inside.
Click on the cryo pod and set the Cryo status to On.
Use the nearby Wrench.png wrench on the O2 canister.png O2 canister to secure it if it isn't already secured. It's secured when it has a black tube in front of it.
Set the Freezer.gif freezer's Target gas temperature to its lowest amount by clicking on the far-left "-" until the number in the center no longer decreases.
Set the freezer to On.
Note: At this point, the clone will begin to heal slowly if cryo was set up correctly, shown by the increasing health indication in the cryo cell's menu.
Click on the cryo cell to check on your clone. When its health reaches 100, it is considered finished and can then be ejected (right-click > Eject Occupant).
Clones often suffer from brain damage, once they're removed from the cryo cell, make sure to administer Alkysine if they suffer from this. The cryo mix should already have Alkysine in it. If it doesn't, yell at the chemist.
DNA Modification
Let's start with a quick practical example to learn how to be a Geneticist, and to learn what you should do at the start of every round:
Grab.png Grab one of the monkeys from the pen.
Click on a Scanner.gif DNA Modifier to stuff the monkey inside.
Click on the Cloning console.gif DNA Modifier Access Console to open its menu.
Click Modify Structural Enzymes.
Click Block and enter the number of the last block - 59.
Click Radiation continuously until the first sub-block in block 59 has a number less than 8.
(Optional) After this step is done, you can right-click the DNA Modifier and Eject DNA Scanner to remove the monkey. It is now a human, albeit a catatonic one.
Glance at all of the 1st sub-blocks (the first character) of all 59 blocks and make sure they are all less than 8.
If any blocks are higher than 8, move to it using the arrow links, then radiate it until it is lower than 8.
Click Main Menu, then click View/Edit/Transfer Buffer.
In the first Buffer section - Buffer 1 - click SE to save the Structural Enzymes of that monkey.
Click Edit Label and enter Clean.
Click Injector to create a syringe with that monkey's genetic DNA inside it.
The syringe will spawn on top of the DNA Modifier Access Console. Click on it to pick it up.
Store your syringe in a place you'll remember (backpack or pocket is fine).
You now have a way of reverting your genes to a clean set without disabilities or powers. This will be extremely useful for all future genetic alterations you do to yourself or others in case you make any mistakes. To inject yourself, simply put the injector in an open hand and click on yourself. Your Structural Enzymes will immediately become like the ones in the injector.
Hexadecimals
The number format in each block is a Hexadecimal. In summary, the numbers and letters are organized like this, from lowest to highest:
0 1 2 3 4 5 6 7 8 9 A B C D E F
Each block has 3 sub-blocks of hexadecimals. For the purpose of this instruction, saying to set a specific block "below 800" means that the first sub-block of that block must be less than 8 - the other two characters in that block don't matter. In another example, setting a block to "above DAC" means:
The first sub-block must be equal to or higher than D (E or F)
The second sub-block must be equal to or higher than A (B, C, D, E, or F)
The third sub-block must be equal to or higher than C (D, E, or F)
Note: If the first sub-block is E or F, you can stop, since (for example) E00 is higher than DAC. For this reason, it is usually recommended to simply radiate the first sub-block and to leave the other two sub-blocks alone.
Unique Identifiers (UI)
Unique Identifiers are your cosmetic details - eye color, skin color, hair style, hair color and gender.
Blocks 1, 2 and 3 for the hair's RGB values, respectively.
Blocks 4, 5 and 6 for the Facial hair's RGB values, respectively.
Block 7 for Skin tone.
Blocks 8, 9 and 10 for the Eyes' RGB values, respectively.
Block 11 for Gender, < 800 = female.
Block 12 for Beard Style
Block 13 for Hair Style.
Unique Enzymes (UE)
Unique enzymes determine your identity, basically the name that people see you as when they examine you, and when you talk. These are separate from unique identifiers, but usually changed together.
Structural Enzymes (SE)
Structural Enzymes contain data relevant to your genetic structure. This governs your race, powers, and disabilities. For those that handle genes with care, however, great benefits are to be had.
Blocks 1 - 58
These are all randomized powers (minor and major) or disabilities.
Block 59
This block governs the race of the subject.
Human = below 800
Monkey = above 800
Powers and Disabilities
Any of blocks 1-58 may be the block for a special power or disability. Powers and disabilities are calculated and randomized at round-start, meaning that whilst they are different each round, they're not different for each person. Additionally, some powers/disabilities can reduce the manifestation chance of other powers/disabilities or suppress them outright.
Minor Powers
All minor powers need to have a block at or above BEA to work and most have a 45% probability of manifesting when applied. This means that you may have the correct block, but still not cause the power to appear. Continued modification of your genome (or just injecting more block injectors into yourself) is needed in this case.
Power Activation Message Notes
Chameleon You feel one with your surroundings When you stand still, you become invisible. You can still be seen when moving, but your sprite will be semi-transparent.
Cold Resistance Your body is filled with warmth You aren't affected by cold temperatures. This, combined with "Breatheless", means you can walk in space without internals and not die in a matter of seconds. You are also conveniently shielded from the damaging lack of pressure, meaning that you can walk out into space without protection. You will still need to breathe, however. It is 30% less likely to manifest if Heat Resistance block is active.
Farsight Your eyes focus. Your camera view zooms out slightly, letting you see things further away more easily. Can be activated with the help of a Cortical Borer. Mutually exclusive with Nearsightedness and Blind.
Heat Resistance Your skin is icy to the touch. You are immune to heat and high pressures. The mirror opposite of Cold Resistance. It is 30% less likely to manifest if the Cold Resistance Block is active.
Morphing Your skin feels strange You can change your appearance at will. Unlike a mirror, this will also let you change your eye color, hair color, skin color, and gender.
Polymorphism You don't feel entirely like yourself somehow You become able to mimic other people's faces, but you can't regain your identity without making a backup.
Quickness Your leg muscles pulsate You move faster than normal.
Regeneration You feel better You can regenerate health faster as well as blood. Won't be enough to raise you from being in critical condition but it helps.
Remote View Your mind expands Allows you to watch other players as if they were cameras (unless they've got the Psy-Resist power), wherever they are (works even on miners on the asteroid). Extremely useful.
Super Fart You feel bloated and gassy Exactly what you think. Makes you fart after a delay with so much force it knocks everything and everyone away from you.
Telepathic Communication You feel your voice can penetrate other minds. You can talk to people through their minds over long distances. This communication cannot be detected or intercepted.
X-Ray Vision The walls suddenly disappear You can see everything in your sight range, even through walls. Combined with Telekinesis, this makes you a force to be reckoned with.
Major Powers
These require a block of DA2 or higher to activate with the % chance of manifesting in () parenthesis, otherwise 45%.
Power Activation Message Notes
Breatheless You feel no need to breathe You do not require oxygen to breathe. You still take Toxin damage from plasma.
Cryokinesis You notice a strange cold tingle in your fingertips You become able to lower the temperature around people.
Dissolve You feel strange and jiggly. Activating this power will cause your skin to slide right off the bone, turning you into a skeleton. In some people's eyes, this is actually a good thing. As a skeleton, you cannot be injected but you can only eat raw meat you can still eat food from a fork. Also gets you out of restraints in an emergency.
Empathetic Thought You suddenly notice more about others than you did before You gain the ability to read minds, know pin numbers, and can figure out which intent a person is currently using. Pretty useful.
Sober You feel unusually sober. You gain the ability to handle your alcohol and cannot become drunk. Can be activated with the help of a Cortical Borer.
Hulk Your muscles hurt You turn green and become super strong. You can't be stunned and your punches can break through reinforced walls. You will unhulk and collapse if you get below 25% health.
Incendiary Mitochondria You suddenly feel rather hot. You gain the ability to burst into flames. However, this does not give you the ability to survive said flames.
No Fingerprints Your fingers feel numb You leave no fingerprints.
Shock Immunity Your skin feels electric You are immune to shocks. This message can also mean other things, so be careful.
Signal Jam Your body and mind feel shielded. Your mind can no longer be read and you cannot be seen via the remote viewing power or cameras. Blocks any attempt at a mindswap, including mind machines and wizard spells. More of a disability than a power, however.
Small Size You feel small. You become a dwarf, able to pass through tables.
Strong You feel buff! Makes you strong. You can tackle harder, pull anvils, crank better and a lot more stuff. You can also carry two-handed stuff (Ian, Gibtonite, Adult Carp, etc) with one hand.
Super Jump Your leg muscles feel taut and strong You become able to jump. Really far. Can change directions mid-jump.
Telekinesis You feel smarter Allows you to move objects with your mind and affect things in your sight range.
Matter Eater You feel hungry You gain the ability to eat anything around you whole. Even people. Only limbs.
Disabilities
As tempting as those powers may seem, there is also a very high chance of you getting a disability. These always manifest when the block is at 802 or higher.
Power Activation Message Notes
Anemia You feel out of breath. Unbuckling from a chair or bed will make you briefly pass out, and your blood count will stay at 501 instead of 560.
Asthma You feel short of breath. Your body will occasionally synthethize mucus, which will suffocate you fairly quickly, unless you take Albuterol.
Blindness You can't seem to see anything You can't see anything. You can still interact with objects near you, or you can get just somebody else to help you.
Chav Ye feel like a reet prat like, innit? Causes ye to talk like a British fellow in a pub. Your Bri'ish ancestry allows you to graffiti with a chisel twice as fast.
Clumsiness You feel lightheaded You drop things a lot, are generally clumsy, and guns explode in your face. Very debilitating. The clown starts with this.
Coughing You start coughing You cough a lot and drop things when you do so.
Deafness It's kinda quiet. You can't hear anything.
Dizzy You feel very dizzy. Makes you stagger.
Electromagnetic Hypersensitivity You feel like electricity burns you. When within 3 tiles of any powered on machinery causes 1 amount of pain for each machine, can be fully negated with a space blanket and tinfoil hat, or the Signal Jam minor power.
Elvis You feel pretty good, honeydoll. Causes you to become the king of rock and roll. This includes body jiggles and drug induced rambling.
Epilepsy You get a headache You randomly have seizures.
Hallucinations Your mind says "Hello" You very frequently get hallucinations (1/20 chance per tick)
Horns A pair of horns erupt from your head. A pair of harmless horns sprout from your head. Great for cult rounds.
Lactose Intolerance Your stomach feels upset and bloated. Causes any dairy products to make you nauseous. Continued consumption of such food will cause toxin damage. You can fart twice as often though.
Lisp Thomething doethn't feel right... You speak like Mike Tyson.
Loud YOU FEEL LIKE YELLING! You can only talk in ALL CAPS! PEOPLE CAN HEAR YOU UP TO 3 TILES OFFSCREEN.
Mute You feel unable to express yourself at all. You become unable to speak at all.
Nearsightedness Your eyes feel weird... You have reduced vision, and require glasses, medicine, carrots or surgery to see better.
Nervousness You feel nervous. You stammer when you talk. You can feel when someone is watching you via cameras. OH GOD THEY FOUND Y-
Noir The Station's bright coloured light hits your eyes for the last time, ... Your vision becomes black and white, and the only color you can see is blood.
Obesity You feel blubbery and lethargic! You become a slow, fat fuck. If removed while under the nutrition threshold for fatness, it instantly removes said fatness as well.
Quiet Your throat feels sore. All speech becomes whispers. People can't overhear you when you speak into a radio and your voice can only be heard in a 5x5 tile radius around yourself (Standard is 7x7).
Radioactive You feel a strange sickness permeate your whole body. You shed any radiation you collect in pulses just like a shard. This radiation can be contained by wearing a Radiation Suit. It can also be harvested for power. Does NOT make you immune to radiation damage.
Smile You feel so happy. Nothing can be wrong with anything :) Causes you to say polite things rather then rude things, and may be compelled to remind people to "check their privilege". Everyone will hate you.
Strangeness You feel strange You start randomly mutating. Very dangerous. Doesn't seem to be in the game.
Swedish You feel Swedish, however that works. Causes you to talk like a Swedish person. Bork Bork Bork! Your Swedish ancestry allows you to assemble Mechanic flatpacks instantly.
Tourette's Syndrome You twitch You twitch and swear randomly.
Toxic Farts Your stomach grumbles unpleasantly. Your farts cause toxin damage to those around you.
Unintelligable You can't seem to form any coherent thoughts! CAUSES!! RETARD!! YOU!!
Vegan You feel vegan. Causes meat, milk, blood, honey and other animal products to make you nauseous. Continued consumption of such food will cause toxin damage.
Wacky You feel an off sensation in your voicebox. When you speak, your words are rendered into Comic Sans. Absolutely devastating.
Quick Unlocking
So, you've played for a while and you're getting bored of grinding for the eventual DA2 on all your genes, huh?
The Gas Chamber
There's also a conveyor lever under the door.
The most efficient method to unlock blocks, but requires some setup and effort.
Go to a small room (we'll assume boxstation's patient rooms on MedBay for this guide, but any small room will do). You must first build the lever (ideally under the door), or the conveyors will not work. You'll need a rod and an attachable remote signaler, put the signaler on the rod and you'll make a lever.
Now that you have a lever, you must make 2 conveyors. Make the rightmost one first (the one closest to the lever so it links up with it) pointing left. Now make the leftmost one, pointing right. You'll end up with conveyors that constantly push towards the other one.
Place 4 lockers on the displayed places, the inner ones are to limit the spread of Mutagen Smoke, the outer one is to prevent leakage.
You'll need 6 bottles, 2 bottles with 10u Mutagen and 10u Sugar, 2 bottles with 10u Mutagen and 10u Potassium and 2 bottles with 10u Mutagen and 10u Phosphorus.
Make (or acquire) 6 IV-Drips (and NOT grenades; you won't be able to make enough to spread enough mutagen and will generally waste time doing this) and place the bottles inside of them. Make sure to separate the IV-Drips into 3 and 3, one bottle of each mix per monkeyman. Place the IV drips on the room, picture for reference. MAKE SURE YOU HAVE 1 OF EACH MIX PER SIDE.
Kill 2 monkeymen and place them on the conveyors, one per conveyor. Link 2 IV drips per monkeyman, open the door.
Quickly link the remaining IVs to their respective monkeymen, activate the conveyors and close the door.
The monkeymen will start to produce Mutagen smoke, the constant movement of the conveyors accelerates the "injection" rate thus unlocking more blocks.
Once the smoke dies down, open the door and move your monkeymen to genetics, they should have most if not all blocks unlocked, maybe 1 or 2 missing.
All blocks under BEA are disabilities, so feel free to ignore those. Disabilities can manifest over BEA though.
Keep a Clean SE injector and an arithrazine pill handy in case you mess the IV timing and get dosed.
The Quick and Dirty Method
Instead of making the smoke contraption, go to chemistry and make 400u of mutagen. Fill a Sprayer with mutagen and disable the pressure nozzle. Make a monkeyman and start spraying away from a distance, refill the sprayer once it empties and keep spraying till you use up the 400u. This unlocks about 60% of all blocks, generally 90% of disabilities and 1 or 2 powers. It isn't as efficient as the Gas Chamber, but it gets the work done fast. Keep some arithrazine handy in case the monkeyman develops the Radiation Disability.
Radiation
Continuing from the above practical example with the monkey (that now looks human) still inside the Scanner.gif DNA Modifier, you have a few options on how to change the monkey's genes:
Radiation Emitter Settings
Change how long and how harshly the monkey gets blasted by radiation. Default settings are adequate.
Pulse Radiation (Main Menu)
Inaccurately and randomly modify any of the monkey's UI or SE with a single pulse.
Radiation (Inside the Modify Unique Identifier or Modify Structural Enzymes sub-menus).
Accurately modify a single sub-block.
The idea is to start at Block 1 of the Structural Enzymes and radiate that block until the number is "DAC" or higher. Then, remove your monkey and see if anything seems strange with him. The catch is - not all disabilities or powers are easily visible. For a dangerous disability like Blindness, you can check your monkey's eyes to make sure their pupils narrow with the penlight you should have:
Move the penlight to an open hand.
Click on the penlight to turn it "On".
Click on the Damage zone.png Damage Zone in the top-right corner of your HUD to indicate that you want to target the eyes.
Click on the monkey to "direct the penlight" into their eyes.
If you see "pupils narrow", the monkey's eyes are normal. An "eerie glow" means X-Ray Vision, and "no reaction" means the monkey is blind.
If you notice something wrong with your monkey, like twitching, you know one of activated blocks is a disability. Make a note of it, then Radiation that block until it's back below 800 to make it normal again. You can also use your injector, or Transfer Buffer > Transfer to > Occupant. Both the injector and occupant-transfer cause a small amount of toxin damage (about 4-5, which can be identified by the occupant's Health %) and between 20-50% radiation (identified by the Radiation Level %). The radiation level can be reduced by using Inject Rejuvenators, and the toxin damage can be cured by using the pills or syringes contained within the First aid anti toxin.png Anti-Toxin First Aid kit on your subject.
Then, continue down the line of blocks until you have a structural enzyme string of only powers with zero disabilities. Saving this buffer is highly recommended unless you don't want someone else to find it (in which case, you could edit the label to something like "All disabilities" to fool people).
Example Scenario
Block 1 is radiated to DAC
Monkey is removed to check for disabilities, but appears to be clean.
Geneticist saves the monkey's SE, outputs it into an injector, and injects himself to see what the block does.
Nothing happens.
Notes: This is a good sign. Because disabilities have a 100% of manifesting above 800, having nothing happen means two things: A) The block is either a minor or major power, and B) You will find the power if you continue to radiate block 1 above DAC. See the above percentage chances that a power will manifest while continuing to radiate that same block above the required hexadecimal.
Random Mutations
At all times, there is a chance that radiating a specific sub-block will not work. Instead, a different random sub-block will be radiated. Furthermore, this chance increases as your subject's Radiation Level increases. This is most identifiable then you radiate a sub-block, but it doesn't change, in which case either:
(Likely) A different, random sub-block of either Unique Identifiers or Structural Enzymes has been modified.
(Unlikely) The radiated sub-block just happened to land on the same number.
This can be easier to control by using Inject Rejuvenators, which will transfer some of the chemicals in the beaker inside the machine to the test subject. You start with two bottles of anti-toxin (which restores health and removes radiation) and two bottles of inaprovaline (why). Get more from chemistry.
Due to this chance of random mutations, you must get in the habit of "cleaning the SE", which involves reading over the first sub-block of every block in the Structural Enzymes to make sure that no other blocks are over 800. For example, if you're testing block 1 and you finally got it above DAC, your process to do so may have inadvertently modified block 2 to 900 (which would cause a disability or a minor power). This would make it difficult to determine what block 1 is doing to your monkey.
Cleaning
In order to "clean" a subject of unwanted disabilities or powers, the key is to make ALL of the Structural Enzymes blocks that you want to be normal less than 800. Unfortunately, if you don't have a set of clean SE saved somewhere, you'll have to scan somebody who has it (most often that somebody is one of your monkeys) and use an injector.
Transfer Buffer
The Transfer Buffer is a useful tool for saving your work, though it is always recommended that you take written notes on each block as you modify them. Furthermore, as stated in the practical example, it is highly recommended to keep a clean buffer saved just in case.
Save
UI (Unique Identifiers)
UI+UE (Unique Identifiers and Unique Enzymes)
SE (Structural Enzymes)
Transfer To
Occupant - Transfers the saved data from that buffer into your subject in the Scanner.gif DNA Modifier. Causes a large amount of radiation to blast the subject. Easier to spawn and use an injector.
Injector - Creates a syringe that you can carry around with you to inject yourself or others with full DNA data stored in the buffer. Causes a small amount of toxin damage, but requires time to produce new injectors.
Block Injector - Creates a syringe that you can carry around with you to inject yourself of other with only 1 DNA block stored in the buffer, and you can even choose which one you want to put in an injector!
Disk - Take a disk from the nearby Diskette Box and click on the Cloning console.gif DNA Modifier Access Console to load it.
Save To - Saves the data from that buffer to the disk.
Load From - Loads data from an existing disk into the DNA Modifier Access Console.
Eject Disk (Main Menu) - Remove the disk.
Mob Modification
Name Change
Get a both a Man to Monkey (Block 59 < 800) and a Monkey to Man (Block 59 > 800) injector.
Turn your patient into a monkey. They won't understand human speech as a monkey, so explain the details beforehand.
Once the patient becomes a monkey, they'll get an option to rename themselves as they please. Wait until they turn from Monkey (543) to whatever name they choose.
Now that the monkey has a proper name, get them inside the gene scanner and copy their UI+UE. This will save the new name.
Take them out of the gene scanner and turn them human again. Once human, inject them with the UI+UE to restore the name.
Sex Change
Get a Block 11 UI Injector from a willing donor. Inject onto your patient. Body is the donor gender now. If there are no available donors, mutate Block 11 to under 800 for male, over 800 for female.
SIMPLE GUIDE TO GENETICS
Before you begin, you may want to grab a medical belt and medhud since they are generally useful. Medical belts can hold genetic syringes and medicine and you can stock up on antitoxins should you need to use it.
Grab some monkeys. One for each geneticist and two others. Ask chemistry for some clonex in a beaker (or make it yourself if you have to) and snag an IV drip from medical storage.
Create a Clean SE using a monkey by dropping down to the last block (Currently 54) and selecting the first letter/number. Radiating this block once (as the first block you pulse) usually does this so that's all you need to do. Save the new monkey-humans SE into a buffer of your choice and label it "clean" or whatever you like.
Make sure all 3-4 monkeys you are using are human using the new block change. Make sure both computers have a clean SE on it even if there's only you in genetics.
Take one of your monkey humans over to the cloner. Alt-click the IV drip you got earlier so that its + sign is red meaning that its taking blood. Your beaker of clonex should be done by now (if not bug chemistry) Make sure it has LESS than the full amount available by 5 units at least. Meaning that a beaker (which holds 50 units) has 45 or less units of clonex. If it has too much use a syringe to extract the excess and put it back later. Place this beaker of clonex into the red IV drip. This will mean that the IV drip should now take blood and put it into the beaker filled with clonex.
Attach your monkey human to the IV drip. This will generate meat for biomass in the cloner and means you have less work to do later.
Now you can work on genes! You should have 2-3 monkey humans left. The other will be used as a blood mule. Take one of your Monkey humans and buckle it to a chair somewhere in your lab. Make sure NOBODY fucks with him. He will be important in a moment
Your 1-2 monkeymen should be in the DNA modifiers. Now you can begin testing. If there is two of you pick an end of the genome and work towards your colleague at the other end.
So if you start at Block 1 it should look something like [1]: [3] [A] [6] Select the first one, or the [3] And it will highlight. Press the Irradiate subject button to attempt to change it.
It will take some tries, but your goal is to get your blocks to be Larger than [1]: [D] [A] [C] The letters have corresponding values meaning A = 10 and F = 16. If you ever have a Genome like [F] [3] [1] that is considered larger than [D] [A] [C] and is excatly fine, the same is true for [E]
Well you irradiate your first block and now it looks like this: [1]: [D] [A] [6] Good job you are almost done! However Getting a [C] is tricky. Usually a better alternative is to go to the Second block instead. So focus on [1]: [D] [A] [6] trying to get it at [B] or higher
You irradiate and irradiate and boom now you have [1]: [D] [C] [6] Great now you can test it.
Move over to the buffer page and place your monkeymans SE into a buffer. Select [Block injector] It will ask for a number, since we were working on [1] select 1 and hit ok.
Inject yourself with your injector. It is important to remember that block injectors only inject you with the block chosen. Regular block injectors inject you with the entire SE. This is bad Don't use the Full injector unless you are working with defectless genomes. (or if you decide to make a genome with all the defects then this is irrelevant)
You inject it and presto you feel strange and jiggly! This is the melting power! Technically a power you would keep it! Head back over to the modification page and to your [1]: [D] [C] [6] Select the [1] and name and color your Gene, generally green is good red is bad and brown is maybe. Dark gray is unknown
Now remember that extra monkey man I had you make? Stick them with the same block injector you did yourself. This monkeyman is all the powers you find. You can use him to make Power SE's for other people without sticking yourself inside the machine and also helps prevent accidentally introducing defects into the SE.
Now do this for all 56 other blocks!
Tips and pointers:
Every individual dose of Mutagen will cause 1 mutation, generally defects, on the subject. Give them many small doses instead of one big dose for best results.
When you find a Defect and you are working alone, having a clean SE in the other computer is fairly helpful for quickly curing yourself. Remember to use block injectors!. Use both machines simultaneously for extra efficiency.
Blocks will randomly mutate during irradiation. This is normal. These are also usually defects but its important to test them anyways and label them as they are
Inject yourself and nothing happens? Also normal. Powers tend to manifest alongside other powers at random or alongside defects. Everytime you change your genome you have a chance to activate any hidden powers. This can make finding out which specific block a power comes from. Powers do not always manifest when you get them but always de-manifest when you cure the block. Some powers also make it more difficult to get other powers (e.g. heat resistance makes cold resistance much less likely to manifest).
Despite being a power, the closed mind power is more of a defect. Being able to communicate with other users of mind powers is disabled when you have it so if you activate it try to remove it from your main power SE.
Hulk tends to be abused. Remember to keep it out of civilian hands.
If you fuck up bad and overwrite your clean SE, Ryetalyn cleans all active blocks and resets you to normalcy. Careful as its also usually in cryotubes, which is why you should use a monkeyhuman as a backup.
If your test subject dies, ignore it. Radiation levels determine how likely you are to change your current block but its far faster and cheaper to just use the super radiated corpse.
-----
Ruth McVork says:
"Welcome to Genetics, brother! Are you feeling good? You SHOULD feel good! You are now like unto a tiny god! Are you prepared to be what you were born to be? Are you ready to save the station (or totally fuck it up)?
Chin up, buddy. It's not that hard. But before you start grabbing those monkeys from the pen, you should know the basics."
Contents
1 The Department
2 DNA Modification
2.1 Unique Enzymes
2.2 Unique Identifiers
2.3 Structural Enzymes
2.4 Genetic Sequencer
2.4.1 Genetic Sequence Scanner
2.5 List of Mutations
2.5.1 Chaplain Religion exclusives
2.5.2 Admin-spawn only mutations
2.6 Guide to finding and using mutations
2.6.1 First Steps
2.6.2 Humanizing a Monkey
2.6.3 Manifesting Mutations
2.6.4 Scramble DNA
2.6.5 Activators and Mutators
2.6.6 Advanced Injectors
2.6.7 Genetic Instability
2.6.8 Chromosome 21
2.7 What to do with your powers
2.8 Healing your subjects and yourself
2.9 CRISPR Editing
2.9.1 Getting a CRISPR Charge
2.9.2 Using a CRISPR Charge
2.9.2.1 Building the CRISPR String
3 DNA Infusion
4 Cloning
4.1 Hark! A Husk!
4.1.1 Changeling Victims
4.2 Helping the Headless
4.3 Cloning Plasmamen
4.4 Empty Cloning
4.5 Cloning Errors
5 The Gene Genie - The Traitorous Geneticist
5.1 Revolutionary
5.2 Traitor
5.3 Changeling
5.4 Returning to Monke
The Department
Genetics.png
Welcome to Genetics.
This room has two DNA Scanners and two DNA Scanner Access Consoles, along with some disk boxes and other supplies. The disks are extremely useful, as we will see later.
A nearby containment room holds your test subjects. These monkeys are going to be your guinea pigs. You are going to experiment on them, and make them suffer quite a bit. It's pretty inhumane. But such is life, and after a while it will all be worth it.
Scanner.gifMedcom.gif DNA Modification
This is the "Enzymes" tab. The "Radiation Emitter" function may randomize certain individual cosmetic features of the person inside, as well as damage their DNA. This menu can be used to transfer identities between people, but it can't be used to change a person's species. This information can also be stored on cloning data disks. Regarding the genetic research, listen to the direct orders of the Research Director
.
Now, let's get you acquainted with the DNA Scanner Access Console. It has a few things of note. First you need to learn some terms:
Unique Enzymes
Unique Enzymes (UE) = Your name. Even if you mutate the UE it will have no effect on the name. What you can do however, is to transfer UE from one person to another, copying their name.
Unique Identifiers
Unique Identifiers (UI) = Your cosmetic details - eye color, skin color, hair style, hair color and gender.
In the DNA scanner access console there is a tab named "Enzymes". This tab can be used to copy UE and UI between people.
Click "Save" to save a person's UE + UI to the console. You can not save mutations this way (anymore).
Click "Transfer" to copy the genes of the buffer to whoever is inside the scanner. You can choose between Enzymes (UE), Identity (UI) and Full Makeup (UE+UI).
Click "Transfer (Delayed)" to copy the genes of the buffer to the next person who steps into the scanner and closes it (such as yourself). This option is only available if the scanner is empty.
Click "Print" to print a DNA injector containing the genes of the saved buffer. Injecting this into a person will transfer the UE, UI or UE+UI to that person. Unlike mutation injectors however, these DNA injectors are not permanent, and will only last for a short while after injected.
Structural Enzymes
Structural Enzymes (SE) / Genetic Sequence = Your mutations. They contain data relevant to your genetic structure. This governs your race and mutations. The term "Structural Enzymes" is no longer used by the DNA scanner access console since it was replaced with "Genetic Sequence" (which is the same thing), but the term may still show up elsewhere.
Genetic Sequencer
This is what the Sequencer tab may look like with a human in the scanner.
In the DNA scanner access console there is a tab named "Sequencer". Here you will alter genes to find mutations. There are four types of blocks: A, T, C and G. Each pair of letters in the boxes are connected. A goes with T, and G goes with C. Order does not matter. Each pair has a correct combination of "AT, TG, CG or GC" that needs to be filled. If you see a an unmodified pair be X-T it means the right combination of that pair is A-T. When all 16 pairs have the right blocks, the mutation will activate and you will be able to store it. Monkeys can only have the monkified mutation unless humanized. Once you have found the name of a mutation, that mutation will be permanently identified in all DNA scanner access consoles.
You might want to disable the monkey mutation by replacing one of the healthy pairs with another letter. How to do all this will be detailed in the guide below.
Gene scanner.gif Genetic Sequence Scanner
What it looks like after clicking someone with the "Genetic Sequence Scanner" item, and then using the Genetic Sequence Scanner in hand and selecting "Mutation 39". Note that we now know that the first pair should be C-G.
The more difficult mutations will have a lot of unknown (X-X) pairs. You cannot just randomly enter A-T, since it's predetermined what it's supposed to be. Knowing all this, you could whip out the genetic sequence scanner Gene scanner.gif from your pocket. If you're looking for the correct pairs of mutation 39, scan people until you find a person with mutation 39. Then use the scanner in your hand for a menu to pop up. In the menu, select "mutation 39". This gives you a reading which will likely give you more information about which pairs you need to finish mutation 39.
What it looks like after correctly filling all pairs. Mutation 39 turned out to be monkified. Since solving a mutation activates it, the subject in the scanner is now a monkey.
You can use your Genetic Sequence Scanner Gene scanner.gif on a DNA scanner access console to permanently synch the item, which makes you see the names of discovered mutations when scanning people with it.
More info about some of the other tabs can be found in the guide further below.
Hulk.png List of Mutations
Before we start splicing, you must know what possible monstrosities can be done to a human. Normally unobtainable mutations are highlighted in red text.
Mutation Name Description Indicators Message How/Where to Obtain Instability
Telekinesis "A strange mutation that allows the holder to interact with objects through thought."
This power allows the subject to control things with their mind, from far away! It is the most sought after power, since it allows for incredible deeds, and makes a strong robuster nearly immortal. To use it, switch to an empty hand and click on an object (note that, if they can, your character/the game will prioritize picking up an object normally over picking it up telekinetically). A circle symbol will appear underneath the object and in your hand and you can now control the object. You can also use any console from a distance.
Appears as a blue glow around the subject's head. "You feel smarter" Genetic / Punished God sect 30
Hulk "A poorly understood genome that causes the holder's muscles to expand, inhibit speech and gives the person a bad skin condition."
Subject becomes extremely strong, enough to punch through reinforced walls, and is unable to speak without yelling. The subject is also immune to stuns and slowdowns from stamina and normal damage, and cannot be pushed past. Breaking walls and machinery deals heavy brute damage to your arm. This mutation is lost when the subject falls to critical health.
Can swing people by their tails. To do this, get your tailed victim in at least a neck grab (lvl 3 grab), enable throw mode, then click in the direction you want to throw.
Makes you extra vulnerable to cold and take brute damage from it.
Prevent you from using weapons [to confirm: and computers and tablets]
Subject turns green and has red eyes. "Your muscles hurt." Radioactive + Strength 40
Temperature Adaptation "A strange mutation that renders the host immune to damage from extreme temperatures, both hot and cold. Does not protect from vacuums [or areas of high pressure]."
This mutation is mutually exclusive with Pressure Adaptation.
Subject has a pulsating orange "aura". "Your body feels warm." Genetic 25
Pressure Adaptation "A strange mutation that renders the host immune to damage from both low and high pressure environments. Does not protect from temperature, including the cold of space [or super hot gas]."
This mutation is mutually exclusive with Temperature Adaptation.
Subject has a pulsating blue "aura". "Your body feels numb." Genetic 25
Thermal Vision "The user of this genome can visually perceive the unique human thermal signature."
Subject can see people even through walls and in darkness. Deals 10 eye damage on use, and lasts 10 (seconds?).
\ "You can see the heat rising off of your skin..." Genetic 25
Chameleon The subject becomes able to subtly alter light patterns to become invisible, as long as they remain still. Subject starts fading into the background. "You feel one with your surroundings." Genetic 25
Dwarfism Turns the subject into a manlet, making them unusually shorter than the rest of the crew. Dwarfs can pass over tables without stopping.
Mutually exclusive with Gigantism
Subject looks smaller. "Everything around you seems to grow.." Human Species 5
Near Sightness "The holder of this mutation has poor eyesight."
Makes the subject's screen go hazy at about halfway from the edge of your whole vision. It's not THAT bad, and can be temporarily fixed by using prescription glasses.
\ "You can't see very well." Genetic
Epilepsy Subject starts to fall down and keeps shaking all the time. Subject suffers from seizures. "You get a headache." Genetic
Coughing Makes the subject drop small items they're holding, like syringes. Pretty harmless, but has potential to be extremely annoying. Subject coughs. "You start coughing." Genetic
Tourette's Syndrome The subject swears all the time. They may also experience paralysis that takes even longer than the seizures. Avoid. Subject curses out loudly and twitches. "You twitch." Genetic
Nervousness Makes the subject stammer. Annoying at best. Subject stammers when they speak. "You feel nervous." Genetic
Blindness Subject goes completely blind, becoming a part of a usually forgotten minority. How sad. Subject's eyes don't react to penlight. "You can't seem to see anything." Genetic
Deafness Makes the subject deaf. Harmless at best, annoying at worst. You just don't hear anything, not even yourself. \ "You can't seem to hear anything..." Genetic
Illiterate Subject becomes illiterate that stops them from using paper, pens, computers, and some electronics that require reading. \ "You feel unable to read or write." Genetic
Clumsiness Inhibits certain brain functions, inducing clown-like clumsiness in subject. For those that have always wanted to be clowns. It makes the subject accidentally drop things they hold, unable to use tasers, handcuffs, guns exploding in their face etc. \ "You feel lightheaded." Genetic/Clowns
Unintelligible Heavily corrupts the part of the brain responsible for forming spoken sentences, causing the subject to only be able to speak short sentences. \ "You can't seem to form any coherent thoughts!" Genetic
Mute Completely shuts down the speech center of the subject's brain. \ "You feel unable to express yourself at all." Genetic / Punished God sect
Wacky Forces the subject to talk in an odd manner. \ "You feel an off sensation in your voicebox." Genetic
Glowy Gives the subject a faint glow of random color.
Mutually exclusive with Anti-Glow
Subject glows. "Your skin begins to glow softly." Genetic 5
Anti-Glow Makes the subject absorb light in a radius around it.
Mutually exclusive with Glow; works for Ethereals and Luminescents
Subject has an aura of darkness. Emit a ring of white light in light-emitting races. "Your skin seems to attract and absorb nearby light creating 'darkness' around you." Glowy + Void Magnet 5
Strength "The user's muscles slightly expand."
Subject feels stronger, but isn't. Combine with Radioactive to make the Hulk power.
\ "You feel stronger" Genetic
Fiery Sweat Subject "sweats liquid fire"[CITATION NEEDED] and randomly combust, but grows more resistant to fire. Tests determined it takes twice the amount of time for the subjects to completely burn (x0.5 modifier on BURN). Stability decreases the chances of combusting. Subject will spontaneously combust "You feel hot." Genetic
Void Magnet "A rare genome that attracts odd forces not usually observed."
You have the power to make yourself mostly invincible for a brief period at the cost of being unable to move. You will also enter this state randomly and against your will, genetic stability reduces how often it happens.
Subject is periodically replaced with a hole in reality shaped like the subject. "You feel a heavy, dull force just beyond the walls watching you." Genetic 30
Radioactive "A volatile mutation that causes the host to sent out deadly beta radiation. This affects both the hosts and their surroundings."
One of the few radiation sources after the Radiation Modernization changes.
Subject glows with a green aura "You feel it in your bones" Genetic 5
Telepathy A mutation that allows the user to telepathically communicate to others. Subject is able to broadcast its thought directly to others. "You hear your thoughts echo in your mind" Genetic / Punished God sect 10
Fire Breath An ancient mutation that gives lizards breath of fire.
Enables the user to fire explosive fireballs, hotter the less it travels.
Subject becomes able to breathe concentrated balls of fire. "You feel a heat built up in your throat" Lizard Species 30
Chav Forces the language center of the subject's brain to construct sentences in a more rudimentary manner. \ "Ye feel like a reet prat like, innit?" Genetic
Swedish "A horrible mutation originating from the distant past. Thought to be eradicated after the incident in 2037."
Forces the language center of the subject's brain to construct sentences in a vaguely norse manner.
\ "You feel Swedish, however that works." Genetic
Medieval "A horrible mutation originating from the distant past, thought to have once been a common gene in all of old world Europe."
Forces the language center and primary motor cortex of the subject's brain to talk and act like a knight on a quest for the Holy Grail.
\ "You feel like seeking the holy grail!." Genetic
Pig Latin "Historians say back in the 2020's humanity spoke entirely in this mystical language."
Increase the level of skillchip' complexity the subject can handle.
\ "Omethingsay eelsfay offyay." Genetic 5
Insulated This makes you shock resistant, not unlike wearing a pair of insulated gloves, without the downsides. The subject does not conduct electricity. "Your fingertips go numb." Genetic 25
Shock Touch "The affected can channel excess electricity through their hands without shocking themselves, allowing them to shock others."
This gives you a non-antag Mansus Grasp shocking people, which will do burn damage and large amounts of jittering and confusion. Does not protect the subject against shocks.
Subject can electrocute other people with their bare hands. "You feel power flow through your hands." Insulated + Radioactive 30
Transcendent Olfaction "Your sense of smell is comparable to that of a canine."
This power lets you track people by scent. Hold something in your hand and use the power to look for a scent on it. Use the power without holding anything and you'll track the scent you previously found.
\ "Smells begin to make more sense..." Genetic 30
Geladikinesis Allows the user to concentrate moisture and sub-zero forces into snow This mutation lets you create snow, used to build snowtiles, walls, balls and snowmen "Your hand feels cold" Genetic 10
Cryokinesis Draws negative energy from the sub-zero void to shoot freezing beams Lets the user shoot a bolt of cryokinesis to freeze people, objects and tiles "Your hand feels cold" Genetic 20
Antenna The affected person sprouts an antenna. This is known to allow them to access common radio channels passively. An antenna is visible on the user's head, and they basically have a built in station-bounced radio. "You feel an antenna sprout from your forehead." Genetic 5
Mind Reader The affected person can look into the recent memories of others.
They can read the minds of others. This will reveal the name of the target and some snippets of what the target has said in the past. Tin foil is known to block this power.
An antenna is visible on the user's head, and the read-ee may feel something strange enter their mind. "You hear distant voices at the corners of your mind." Antenna + Paranoia / Punished God sect 40
Spatial Instability The victim of the mutation has a very weak link to spatial reality, and may be displaced. Often causes extreme nausea. Subject randomly teleports a short distance away and has a tendency to increase the janitor's workload. "The space around you twists sickeningly." Genetic 10
Paranoia "Subject is easily terrified, and may suffer from hallucinations." Subject screams frequently "You feel screams echo through your mind..." Genetic
Gigantism The cells within the subject spread out to cover more area, making them appear larger.
Subjects show increased tackling abilities, both offensive and defensive. Mutually exclusive with Dwarfism
Subject is slightly larger than normal "Everything around you seems to shrink.." Genetic
Two Left Feet "A mutation that replaces the right foot with another left foot. Symptoms include kissing the floor when taking a step." Subject is randomly knocked down. "Your right foot feels... left." Genetic
Autonomy Allows a creature to voluntarily discard a random limb, to help it escape from predators. \ "Your joints feel loose." Genetic 30
Tongue Spike Allows a creature to voluntary shoot their tongue out as a deadly weapon.
The tongue does not grow back, and remains embedded in the target until removed.
Subject can shoot his tongue. "Your feel like you can throw your voice." Genetic 15
Stimmed The user's chemical balance is more robust. (Does nothing.) \ "You feel stimmed." Genetic
Chem Spike Allows a creature to voluntary shoot their tongue out as biomass, allowing a long range transfer of chemicals.
The tongue does not grow back, and remains embedded in the target until removed. As long as it is embedded, it allows you to transfer the chemical in your body into the target's, one single time. Much less harmful than Tongue Spike on its own.
Subject can shoot his tongue, and inject you with chemicals. "Your feel like you can really connect with people by throwing your voice." Tongue Spike + Stimmed 15
Webbing Production Allows the user to lay webbing, and travel through it.
Subject may grow psychologically attached to laying webs if used enough.
Subject lays webbing, or can move through some without being slowed down. "Your skin feels webby." Genetic 15
Internal Martyrdom "A mutation that makes the body destruct when near death. Not damaging to others, but very, VERY disorienting."
Harmful to witnesses' eyes. Paralyze silicons as well.
Subject explodes in a bloody shower when in deep crit. "You get an intense feeling of heartburn." Strong + Stimmed
H.A.R.S. A mutation that makes the body reject the head. Stands for Head Allergic Rejection Syndrome. Warning: Removing this mutation is very dangerous, though it will regenerate head organs. Subject loses their head, including eyes, ears, tongue etc. "Something feels off." Genetic
Acidic Flesh "Subject has acidic chemicals building up underneath the skin. This is often lethal."
Those buildups end up as acidic cutaneous eruptions, burning the subject. Acid-resistant clothes have been shown to protect the subject from those.
The subject's skin frequently bubbles and pops, burning the subject. "A horrible burning sensation envelops you as your flesh turns to acid." Genetic
Spastic "Subject suffers from muscle spasms."
Subject may unintentionnally hit nearby people and machinery, and harm themselves.
Subject frequently spasms. "You flinch." Genetic
Monkified "A strange genome, believing to be what differentiates monkeys from humans."
Transforms subject into a monkey. Innate mutation in humans and monkeys.
Subject frequently spasms. "You feel unusually monkey-like." Genetic
Autotomy "Allows a creature to voluntary discard a random appendage." Subject is able to discard its limbs without surgery. "Your joints feel loose." Genetic 30
Biotech Compatibility "Subject is more compatibile with biotechnology such as skillchips."
Increase the level of skillchip' complexity the subject can handle.
\ No message Genetic 5
Clever "Causes the subject to feel just a little bit smarter. Most effective in specimens with low levels of intelligence."
Allows some mobs, such as monkeys, to perform advanced actions like surgery, use computers and PDAs, and more.
\ "You feel a little bit smarter." Genetic 20
Stoner "A common mutation that severely decreases intelligence."
Grants the Beach Bum language, revokes all the others.
\ "You feel...totally chill, man!" Beach Bum respawn
Chaplain Religion exclusives
Mutations granted by some of the Chaplain's religions. Their instability is set at 0.
"Less of a genome and more of a forceful rewrite of genes. Nothing Nanotrasen supplies allows for a genetic restructure like this..."
Name Description Message
Honorbound "The user feels compelled to follow supposed "rules of combat" but in reality they physically are unable to. Their brain is rewired to excuse any curious inabilities that arise from this odd effect."
Disallows the subject to attack people unless they are attacked first.
"You feel honorbound!"
Burdened "The user feels compelled to injure themselves in various incapacitating and horrific ways. Oddly enough, this gene seems to be connected to several other ones, possibly ready to trigger more genetic changes in the future."
Grants Telepathy and Mute, then Telekinesis and Mind Reader as the subject becomes increasingly burdened through disabilities and debuffs (traumas, missing limbs and organs, addictions, mutations, ...).
"You feel burdened!"
Admin-spawn only mutations
Name Description Indicators Message Instability
X-Ray Vision "A strange genome that allows the user to see between the spaces of walls."
Basically it gives the subject the ability to see everything that is beyond their normal vision: walls, furniture, even other people! This, combined with Telekinesis, is a deadly combination. Essentially replaced by the X-Ray implant.
Subject's eyes "glow eerily" if looked at with a penlight. "The walls suddenly disappear." 35
Laser Eyes "Reflects concentrated light back from the eyes."
Enables to shoot laser beams (dmg 20).
[to confirm] Subject's eyes glow "You feel pressure building up behind your eyes."
Elvis Forces the language center and primary motor cortex of the subject's brain to talk and act like the King of Rock and Roll. A terrifying mutation named after its 'patient-zero'. "You feel pretty good, honeydoll."
Unstable DNA Makes the subject randomly mutate. Very dangerous. Definitely be careful with this one. Strange mutation that causes the holder to randomly mutate. "You feel strange."
Guide to finding and using mutations
This guide here shows you step by step how to find the powers from the mysterious blocks!
First Steps
This guide will start with using a monkey, because they're in the pen for a reason.
Start by taking a monkey from the pen.
Shove it into a DNA Scanner next to the pen, by click dragging.
Check the console next to it, you'll see a bunch of options. Find Genetic Sequencer.
All mutations are randomized every round.
Humanizing a Monkey
Always humanize your monkey first, or their powers wont work or be savable.
You and your geneticist buddy automatically share the mutations you've discovered, so work togheter to discover them all.
Click through the mutations and find Monkified. Then break a random pair by changing a letter to X.
When you've done it, you'll see the name on the top has changed from "monkey" to a randomly generated name. Congratulations, you've got your very own monkey-person!
If for any reason you got yourself some bad mutations and have no one to remove them, grab the mutadone pill bottle in your lab. You usually have several 50u pills available, which is overkill. Dissolve a pill by pouring a tiny amount of water into a beaker (by using the beaker on a sink once), then drop a pill of mutadone into it and take a sip. It should instantly clear all your mutations.
Mutadone will also clear the monkified mutation from monkeys, instantly turning them human. Use a dropper set to 1u to squirt the dissolved mutadone into the eyes of monkeys to mass humanize them without needing any machinery. This will not make you "discover" the monkified mutation however.
Manifesting Mutations
Back to business! Now we'll try to make a mutation show itself to us:
Find a mutation that has broken pairs.
Start filling in the X's. This is fairly easy since most of them are connected to an A, T, C or G. So X-T would be A-T.
The left click increments from A to G (A>T>C>G>A) — the right click, the other way around.
You will often find X-X pairs. Make sure the rest is fixed first and then guess it. There's 4 possibilities. AT, TA, GC and CG.
If there's more than 2 double X-pairs, consider using the Genetic Scanner (as described above) by scanning the other monkeys, yourself, or random crewmembers, or the JOKER option when editing a letter, which finds the correct letter for you (on a very long cooldown—20 minutes on unupgraded scanners).
If completing all pairs didn't work, you may have messed up somewhere. Double check. Also make sure they're not still a monkey. If all else fails, move on to another mutation or scramble their DNA.
Scramble DNA
Clicking the Scramble DNA button will blast the subject's DNA with damaging genetic pulses, and randomize which discoverable mutations it has.
DNA Injector.png Activators and Mutators
After manifesting a mutation in the Genetic Sequencer tab, hit store to save it to the "Storage - Mutations" tab. You can print activators and mutators from both the Sequencer and the Storage - Mutations tab.
Activators: An activator will permanently activate specific mutation in a person who already has mutation dormant as shown with a Genetic Sequence Scanner Gene scanner.gif. For example, since all humans have the monkified mutation dormant in them, a monkified activator will always work on humans. Using an activator will not increase genetic instability. Used activators can be recycled into the DNA scanner access console to produce chromosomes.
Mutators: A mutator will manifest a mutation in a person, regardless of if that person has that mutation dormant or not. This will inflict the mutation's instability (causes death if it reaches 100%). The mutation and its instability may then be removed by taking Mutadone.
The DNA Scanner Access Console takes time to recharge after producing an activator or mutators. The activator has a much shorter cooldown.
DNA Injector.png Advanced Injectors
This is the "Adv. Injectors" tab.
After discovering one or more mutations, you have the option to create advanced injectors. Advanced injectors will let you save multiple mutations in a single injector. The amount of mutations in a single "save" is limited to 50 instability or 10 mutations. Unlike activators or ordinary mutators, these can be named anything you want. To create an advanced injector, do the following:
Go to either the "Storage - Adv. Injectors" tab. Click "Create new injector" and choose a name to crate a new slot for mutations to be stored in.
Go to the Sequencer tab or the "Storage - Mutations" tab and click on a stored or discovered and active mutation.
Click "Add to advanced injector". Select the name of the slot you made in step 1. Repeat with any other mutations you wish to save to the same advanced injector.
Go back to the "Adv. Injectors". Click Print. You will print an injector with named "Advanced (name) injector".
Genetic Instability
When you manifest a power, you may get a message like "It feels like your skin is moving." This is telling you that your genetic instability has gotten higher, and you'll need to be careful not to add too many more powers. All humans can withstand up to 99 genetic instability before they start to bubble and melt. 100 instability would be too much. What happens when you suffer from a genetic breakdown is random and unpredictable. Negative mutations generally don't give you instability, but powers do. As a rule of thumb, the stronger the power, the more instability it gives. Choose your powers wisely.
Chromosome 21
Every time you successfully use an ACTIVATOR on another person, the activator becomes filled with genetic data. Recycle/use it on your DNA console for a 60% chance to gain a random chromosome. The chromosome gets stored in the "Storage - Chromosomes" tab. Clicking on a chromosome gives you information about it. You can also eject it into its physical form. Physical chromosomes can only be used by inserting them into a DNA console.
Each active mutation in a person has a single chromosome slot. You can only add chromosomes to people who are inside the connected DNA scanner. Do so by opening the Sequencer tab. Then click an activated mutation, or find one if none is active yet. You should see the line Select a chromosome followed by a list of chromosomes that mutation would be compatible with. Select a chromosome in the dropdown menu and you have now filled that mutation's chromosome slot. To delete the chromosome from a mutation you need to deactivate and reactivate the mutation by changing any letter and then back.
After you have added a chromosome to a mutation, you can store it to the Storage - mutations tab as normal (by clicking Save to console in the Sequencer tab). Mutations from mutators/activators printed from this stored entry will then contain that chromosome. The stored entry will retain its applied chromosome if saved to a Genetics data disk and transferred to a different DNA Scanner console.
These are the currently available chromosomes you can get (the chance for a chromosome to be of a specific type is listed next to that type in parenthesis):
Synchronizer (5/16): Gives the mind more control over the mutation, reducing some downsides by 50%.
Stabilizer (1/16): The rarest chromosome. Reduces instability gained from the mutation by 20%.
Power (5/16): Boosts strength of certain mutations. Experiment with super sneeze or even deadlier fireballs!
Energetic (5/16): Reduces cooldown on action based mutations.
Reinforcement (3/19): Makes the mutation immune to mutadone. Removed Aug 2020.
Chromosomes aren't supposed to be addable to mutations that won't benefit from them. For example, you can't use the energetic chromosome on the monkey mutation.
What to do with your powers
Export your best powers to a disk, as a backup. There's always the risk of an AI or someone else deleting them for any reason.
Make injectors to give to the greytide the heads of staff, the security, or the Engineers. You can also sell them for money!
Because injectors exist, geneticists may often be asked for powers by randoms. Use your best judgement to decide who gets powers and not, because nothing gets the station down like a herd of assistants with Hulk. Be ready to say "no" a lot. You are allowed to have powers, but if you run around the station while being a hulk don't go on a killing/destroying rampage as that's a bannable offense.
Enjoy being the peak of human evolution! Use your powers for the greater good, or to make security's life hell by breaking down walls to high security areas and by being unstunnable. Remember that hulks are nonhuman to the AI, though, and when security can't stun someone they'll take out their lethals.
Healing your subjects and yourself
During your experiments, your subjects are likely to get hurt, whether from banging their heads on the tube, or negative mutations—most notably H.A.R.S. and Radioactive. If unlucky, you may also be hurt. For that, there are several solutions:
The Roboticist can build medibots. The white ones will heal blunt damage, but there also are the green and yellow versions, able to heal tox/rads and burn damage, respectively.
The Chemists can provide you specific medicines, including Potassium Iodide for radiations (and toxins in irradiated carbons), Pentetic Acid for toxins and rads, and several others for burns, brute, or whatever else you may need.
Beware that Radioactive subjects may irradiate you and nearby items, so quickly remove that mutation once found.
CRISPR Editing
This allows you to swap out base mutations in a targeted way. Base mutations don't suffer from instability
Getting a CRISPR Charge
First, you'll need to collect a CRISPR charge. This is a sample of a virus with genetic abilities you can use to swap out base mutations.
Get the Viro to make a virus with either Dormant DNA Activator or Viral Evolutionary Acceleration (Ideally otherwise benign)
Have a containment protocol, get yourself scanned for diseases if you get symptoms, hope the cure is available if things go south
Infect a contained monkey, use an Activator (not a Mutator) on it - it collects the charge when it collects chromosomes
Feed the used activator to the console to add the charge to the console
Using a CRISPR Charge
You'll need the top row of the sequence pairs of both the mutation you want to target and the mutation you want to replace it with. Here's the basic flow:
Solve the mutation you want or just use a mutator on a humanized monkey
Take note of the top row
On the subject you want to swap mutations on, solve the mutation you want to swap
Use a CRISPR charge on it
Feed in a special CRISPR string instructing the virus to replace that mutation with the desired mutation
Building the CRISPR String
For example, let's say Epilepsy is
A T T A C G C G A T T A C G C G
T A A T G C G C T A A T G C G C
And Telekinesis is
A T A T C C G G A T T A C C G G
T A T A G G C C T A A T G G C C
Take note of the first row of both
Epilepsy is A T T A C G C G A T T A C G C G
Telekinesis is A T A T C C G G A T T A C C G G
You then need to weave these rows together, old-new-old-new-old-new like this:
_A T A T C C G G A T T A C C G G :NEW (Telekinesis)
AATTTAATCCGCCGGGAATTTTAACCGCCGGG :CRISPR String
A T T A C G C G A T T A C G C G_ :OLD (Epilepsy)
Now, when you use CRISPR on the solved base mutation you intend to swap, feed in that string! It swaps Epilepsy out for Telekinesis.
AATTTAATCCGCCGGGAATTTTAACCGCCGGG
If your string is not the right length, nothing happens, but if the string is wrong, you may end up with Acid Flesh instead, but scrambled and with no guides - hope you've got activators! Careful not to be wrong multiple times, lest you overwrite multiple mutations to the same one and need to shuffle to get them back.
Also, the CRISPR charge, being a repurposed virus, might sometimes go rogue and infect you randomly.
Congratulations. If you read everything in this guide, you should now be a full-fledged Geneticist.
DNA Infusion
Just settling with regular-old mutations not enough? Feel a need to TRANSCEND your human form? Maybe a little too into those weird Japanese cartoons? The brand new DNA infuser located genetics lets you become part BEAST, through... science! All you have to do is stick a corpse of a viable (or not) animal in and a live test subject, and the machine will destroy the corpse to replace one of the test subject's organs with a brand new mutant set. Enough mutant organs from the same type will make you a proper mutant of that type, possibly changing your species or conveying other positive or negative effects!
Mutant Type Animals with Matching DNA Possible Mutant Organs Organs Required for Set Bonus Set Bonus
Rejected Any not listed here Fly eyes, proboscis, fly heart, fly lungs,fly liver, fly stomach, fly appendix. 4 Turns you into a fully fledged flyperson, like you can become from messing up teleportation. Why the hell would you want to do this?
Carp Space carp Carp lungs (let you breathe in space but NOT on station),
Carp jaws (Stronger bites and can drop carp teeth, but can't cover knives),
Carp brain, carp heart.
4 Allows you to move freely through space, like a carp can!
Rat Rodents Rat eyes (light sensitive but have night vision), rat stomach, rat heart,
rat tongue.
4 Gain the ability to crawl through station ventilation, as long as your clothes don't get in the way.
Goliath Goliaths Goliath eyes (night vision), goliath lungs (lets you breathe on lavaland but
NOT on station), goliath brain (no gloves but one of your arms becomes a
tendril hammer), goliath heart (makes you immune to ash storms.)
4 Makes you immune to lava.
Cat Cat Cat ears, cat tail. N/A You're part cat now, just like in those cartoons with those girls you like so much.
Fox Fox Fox ears. N/A You have fox ears, just like that girl on that poster you keep on your wall.
Scanner.gifMedcom.gifClone.gif Cloning
Cloning was removed from the game in Jan, 2020. This is only for historical reference.
Expand for the old guide to cloning.
For a cloning process we need a dead body and cloning equipment, which can be found in your Cloning Room.
First of all, you have to know that for all things cloning, the Chief Medical Officer has a final say. He is your boss on this side of Genetics. If he tells you to clone someone and not some other guy, you do it. The only person with higher say than him on these matters is the Captain.
On to the specifics! How to clone: Just grab or pull a body and stuff it into the DNA Scanner and close the door. If you want to remove someone from a Scanner, click on it to open the door. Unless the Scanner is locked, the person/monkey inside is going to pop right out.
This is the cloning console menu.
When the Scanner is occupied, interact with the Cloning Console. You will see a few options. The most important one is "scan". Click it. If they can be cloned, scanning will succeed regardless of whether they're in their body or not. There are several possible errors that can happen when you try to scan. See the section about cloning errors for details.
If scanning is successful, you will get a Successful Scan -message. That means you now have that person's cloning data saved. You can use this record to steal their genetic data at any time, but cloning is more limited - if their last death happened after they got scanned, any attempts to clone using the scanned record will fail.
This is what you see after clicking "View Records".
After you actually have DNA data from a person, click Check Records, and then click View Record of the person who you want to clone. You will see a list of their UI(Unique Identifiers) and their SEs (Structural Enzymes). These can be copied and pasted with a cloning data disk (see one of the images to the right). Click Clone. You will notice that the Cloning Pod is now fully active, with a shadow inside. That is the new body. You can now take the old corpse out of the DNA Scanner, strip it completely so the cloned person can have their stuff back, and place the old corpse inside a body bag in the morgue. You don't have to worry about the old corpse anymore.
This is what can you see after clicking a specific "View Record" under "View Records". If you have an ID with cloning access you can delete a record. Otherwise it will say "access denied" when trying to delete it. If you have inserted a "cloning data disk" you have additional options to save or load UE, UI and SE (dormant mutations) to and from that disk.
The cloning process takes about 2 or 3 minutes depending on upgrades. For whoever is getting cloned, it may feel like a very long time. While the person is getting their new body formed, take their belongings and stuff them all into a locker, so they're not scattered all over or stolen. Cloning the captain and leaving their ID or other secure items on the floor is bad.
Aborted cloning: Use this as traitor to screw with that assistant who talked smack to you earlier. During the cloning process, it is possible to eject the incomplete clone by unlocking the Cloning Pod with your ID and ejecting the unfinished clone (needs to be >40% done) or by getting an Engineer to unlock the Genetics APC so you can shut off the power temporarily, which also causes the clone to (instantly, no matter how done) eject. This will usually clone people without limbs or vital organs, making them die quickly.
The cloned people often have cellular damage. If so, take them to cryo to fix it.
After the pod is empty, feel free to clone your next patient, and to let the old one out, since they most likely don't have clearance to open the door.
If R&D has been doing their job, they might upgrade the cloner to a level where it can autoprocess. If this is the case, you only have to press the Autoprocess button on top of the window, and the cloner will scan and clone automatically. This is useful to process a large pile of bodies quickly. Scan them one at a time, and autoprocess will do the rest.
OH GOD OH FUCK Hark! A Husk!
So you've come across a husk (a grey corpse) on your floor, which means you can't clone that poor sod without upgrades. Before you go throwing that body in the morgue, they can still be helped!
First off, make sure it's a husk. Throw the body into a DNA Scanner, if it says Subject no longer contains the fundamental materials required to create a living clone, then you have yourself a husk (if your DNA Scanner had been updated to the max by the Scientists, you could clone the husk right now. So if you know they've been doing their R&D, ask them).
Take the body down to Surgery.
Pester the CMO or a Medical Doctor to extract the brain, or do it yourself.
Put the brain in the DNA scanner like you would a body.
Optionally a husk can be unhusked with rezadone. If all goes well then your cadaver will be reborn.
Changeling Victims
If examining the husk shows "He/she is limp and unresponsive; there are no signs of life... " it means the body has a soul online. If the corpse still can't be scanned in fully upgraded cloning, it's possible it was someone who got absorbed by a changeling. There appears to be no easy way to revive absorbed victims. Not even through brain transplants.
Helping the Headless
Sometimes you'll find a corpse whose head is separated from their body. Thanks to the marvels of modern science, this is not a problem!
If you have a head or a brain, just chuck it into the cloner as normal. This may require the DNA scanner to be upgraded though. To clone a head or brain you must throw it into the DNA Scanner by activating throw with R and then clicking it, or by walking into the DNA scanner and dropping the head/brain. Then click the cloner to close it.
If you don't have the head, but you have the body, not all hope is lost: take a blood sample and give it to the botanist to make a replica pod, and the deceased guy will be reborn as a podperson!
If you have neither, he's dead for good.
Cloning Plasmamen
If the patient is a plasmaman, cloning them will be complicated by the fact that the naked patient will burn in the station's atmosphere. This can be dealt with by using showers to keep the patient from catching fire, then dressing them in a plasma envirosuit.
Put plasmaman into cloning scanner
Scan them, start the cloning process
Drag their dead body to cloning pod
Undress them and leave their clothes in a pile
Turn on shower near cloning pod
Once they pop out of cloner, put them under shower and wait for them to dress up
If the patient is a naked or beheaded plasmaman, follow these additional steps:
Once they pop out of cloner, put them under shower and feed them a few Salbutamol pills (if available), or if desperate, keep a syringe of Perfluorodecalin ready in case you need it. Plasmamen suffocate if they don't have plasma to breathe!
Yell at cargo to order plasmaman supplies. In the meantime, bug Engineering/Atmos for a filled plasma tank.
Empty Cloning
Cloners have the option to "Empty Clone" a record, creating a mindless replica of a person. To complement this function, cloners can do Body-Only scans, which can only be used to create empty clones but not real clones, and bypass the sentience restrictions that ordinary scans have. These body-only entries can be deleted without requiring access.
Cloning Errors
Error message Cause Solution
Unable to locate valid genetic data. Whatever you put inside the scanner doesn't have valid (humanoid) DNA. Stop putting bees in the scanner.
Subject's brain is not responding to scanning stimuli. The person inside has suicided or signed an infernal contract. Cloning is impossible. Let the Cook take care of them or put the body in the morgue.
Subject no longer contains the fundamental materials required to create a living clone. You're trying to scan a body that's been husked or smashed by megafauna, but your scanner doesn't have a (tri-)phasic scanning module. Remove the brain and scan it. Yell at RnD to upgrade your scanner.
Mental interface failure. The corpse has no ghost associated with it. Try again in a few seconds - ghosts get notified when someone attempts to scan their body. No success? Let the Cook handle it.
Subject already in database. That person has already been scanned. Start the cloning process. Want to update the current clone scan? The CMO can delete scan files.
Initialisation failure. The patient is still alive. Try again when the patient is dead.
Unable to initiate cloning cycle. Cloning has been disabled in the server config. Yell at admins and hand the corpse over to the Chef.
Corpse has no head. Some asshole decapitated your guy - clone scanning is impossible without a brain. Draw a blood sample and ask Botany to clone them with the Replica Pod plant. Can't draw blood either? Your patient is out of luck.
Keep in mind that patching up a corpse with Synthflesh and then reviving it with Strange Reagent bypasses a lot of these issues.
The Gene Genie - The Traitorous Geneticist
Sorry for the bad chapter title. I wanted to use that for a very long time.
So, you learned how to do your job successfully, and how to be a credit to the station. You learned how to manipulate genes. Now you want to learn what the hell to do when the syndicate is the one writing your checks! Well, fret not! I will give you some pointers. But these are mostly tips - traitorous objectives differ wildly, and change your actions way too much for me to write a real guide on it.
Revolutionary
If you managed to kill a head of staff, copy their identity with a DNA scanner and apply it to yourself. Impersonating a head of staff during a revolution is useful since they are usually exempt from implanting.
Traitor
Depends on your objective. If it's a hard one, like stealing the AI... well, you're fucked. Keep working on those powers! As soon as you have Hulk + TK, go for it as you wish. No tips here.
If your objective is a simple one, though, like stealing the hand tele, there are more approaches to this. As the above tip, you can just break the walls with TK Hulk, but that is rather crass. There's a more roundabout, but classier way to tackle this. Take a monkey from the pen, transform it in a human. Take its UI+UEs, make an injector, stuff it in your pocket with a label like "Clean Backup - Alexa White".
Now get your own UI+UEs and name it "Clean Backup - Original" or something. Avoid using your name. Now, go hide somewhere close to the item's location, stick yourself with the monkey injector, spawn doorjack, stick ID and PDA in your backpack. For added stealth, get a different outfit. doorjack your way to the captain's room, get his hand tele, RUN RUN RUN. The AI might see you, so it would also be good if you spawned an agent card so you can't be tracked. If anyone sees you, they're not going to see your actual name, only the humanized monkey's name. Hide, stick yourself with your own stuff, change clothes, walk away smoothly.
If you have to kill someone, same stuff from rev.
Also, never forget identity theft. Since you can take someone's complete identity, including looks, you can have some fun with that.
Changeling
You can DNA sting humanized monkeys to quickly gather stored genomes. Similarly, once people start coming for mutations, you will have plenty of DNA to collect.
Returning to Monke
If you're looking for combat or stealth bonuses, you may use Monkified to get the monkeys', as well as several useful mutations (e.g., Telekinesis, Shock Touch, Chameleon, Gigantism and Dwarfism). Monkeys have the ability to steal items from people's hands, ventcrawl, and several other benefits. The transformation is unexpensive and available extremely early in the round (unlike the Xenobiologist's slime transformation).
Alternatively, there are gorillas. Since the radiation modernization changes (Oct, 2021), you have a nearly-exclusive access to gorillas. You may transform monkeys into gorillas, including yourself, other crewmembers or antagonists.
Given their status as a simplemob, gorillas are immune to wounds and most chemicals—essentially the Hulk's weaknesses. They are additionally immune to stuns and shoves (like Hulks), viruses, and mutations. Unlike Hulks, they are unable to destroy reinforced walls.
Note that gorillas are thus also immune to the benefits of those, and to surgeries. Healing is going to be more complicated than for hulks, and someone may Lazarus their carcasses to assist against the other gorillas.
The gorilla AI is extremely hostile, keeping aggro until their target is dead, and have a tendency to delimb corpses people that are unconscious (incl. hard crit).
To transform a monkey into a gorilla, you have two options:
Genetic bombing: once above 2500 genetic damage, monkeys have a 25% chance per second to transform.
Mind-Magnification Helmets: when removing MM helmets, the sentient monkey has a slight chance (2.5%) to turn into an equally sentient gorilla.
Additionally, the Traitor geneticist's uplink offers Gorilla Cubes and an autoinjector turning them into a gorilla.